Transcript: Human NM_001001963.1

Homo sapiens olfactory receptor family 2 subfamily L member 8 (gene/pseudogene) (OR2L8), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
OR2L8 (391190)
Length:
939
CDS:
1..939

Additional Resources:

NCBI RefSeq record:
NM_001001963.1
NBCI Gene record:
OR2L8 (391190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189293 CCAGGTTCTCTTTGCTGTCTA pLKO.1 654 CDS 100% 4.950 2.970 N OR2L8 n/a
2 TRCN0000188862 GCCACCATCTTTCTCGTGTTT pLKO.1 604 CDS 100% 4.950 2.970 N OR2L8 n/a
3 TRCN0000187983 CCACCATCAAGAATTGACCTT pLKO.1 52 CDS 100% 2.640 1.584 N OR2L8 n/a
4 TRCN0000583913 CTCCCTCATTGACCTAAATTA pLKO_005 195 CDS 100% 15.000 7.500 Y n/a
5 TRCN0000583929 TCTCCCTCATTGACCTAAATT pLKO_005 194 CDS 100% 15.000 7.500 Y n/a
6 TRCN0000584083 TCTCCACACACCCATGTATTT pLKO_005 159 CDS 100% 13.200 6.600 Y n/a
7 TRCN0000359904 ATCCAGGGCCATCAATCATTT pLKO_005 507 CDS 100% 13.200 6.600 Y OR2L3 n/a
8 TRCN0000359835 CTCTCCCTCATTGACCTAAAT pLKO_005 193 CDS 100% 13.200 6.600 Y OR2L3 n/a
9 TRCN0000359837 GGATCATAGGCTCGATCAATG pLKO_005 443 CDS 100% 10.800 5.400 Y OR2L3 n/a
10 TRCN0000061293 CCCACCTCACTGTAGTAACTT pLKO.1 725 CDS 100% 5.625 2.813 Y OR2L3 n/a
11 TRCN0000202646 CTAAATTACATCTCCACCATT pLKO.1 208 CDS 100% 4.950 2.475 Y OR2L8 n/a
12 TRCN0000061294 CCTAAATTACATCTCCACCAT pLKO.1 207 CDS 100% 2.640 1.320 Y OR2L3 n/a
13 TRCN0000186136 CCTAAATTACATCTCCACCAT pLKO.1 207 CDS 100% 2.640 1.320 Y OR2L8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02938 pDONR223 100% 89.1% 85.5% None (many diffs) n/a
2 ccsbBroad304_02938 pLX_304 0% 89.1% 85.5% V5 (many diffs) n/a
3 TRCN0000491631 AGATCAACGCGCCCATACGCACAT pLX_317 19.9% 89.1% 85.5% V5 (many diffs) n/a
Download CSV