Transcript: Human NM_001002026.3

Homo sapiens claudin 18 (CLDN18), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CLDN18 (51208)
Length:
3347
CDS:
54..839

Additional Resources:

NCBI RefSeq record:
NM_001002026.3
NBCI Gene record:
CLDN18 (51208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429247 CCTCCGGGATCATGTTCATTG pLKO_005 412 CDS 100% 10.800 15.120 N CLDN18 n/a
2 TRCN0000116741 CTGGATGTCCACAGCTAACAT pLKO.1 494 CDS 100% 5.625 7.875 N CLDN18 n/a
3 TRCN0000116738 CCAACTACAAAGCCGTTTCTT pLKO.1 664 CDS 100% 5.625 4.500 N CLDN18 n/a
4 TRCN0000116739 GAGGACGAGGTACAATCTTAT pLKO.1 795 CDS 100% 13.200 9.240 N CLDN18 n/a
5 TRCN0000417578 TAAACCCATTGATGATCTATT pLKO_005 1186 3UTR 100% 13.200 9.240 N CLDN18 n/a
6 TRCN0000417611 TAGAGGCTATAGCTCACATTT pLKO_005 1048 3UTR 100% 13.200 9.240 N CLDN18 n/a
7 TRCN0000116740 GCCCTGAAATGCATCCGCATT pLKO.1 351 CDS 100% 0.405 0.284 N CLDN18 n/a
8 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 2396 3UTR 100% 13.200 6.600 Y CLDN18 n/a
9 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 1855 3UTR 100% 4.950 2.475 Y DENND6A n/a
10 TRCN0000175984 GATTTCATCTTTGGAGAGGAT pLKO.1 960 3UTR 100% 2.640 1.848 N Babam2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03245 pDONR223 100% 91.5% 91.9% None (many diffs) n/a
2 ccsbBroad304_03245 pLX_304 0% 91.5% 91.9% V5 (many diffs) n/a
3 TRCN0000476569 AACGGACTTGCCTCCATAAGCTCG pLX_317 53.8% 91.5% 91.9% V5 (many diffs) n/a
Download CSV