Transcript: Human NM_001002847.3

Homo sapiens DERPC proline and glycine rich nuclear protein (DERPC), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
DERPC (113455421)
Length:
2804
CDS:
385..1959

Additional Resources:

NCBI RefSeq record:
NM_001002847.3
NBCI Gene record:
DERPC (113455421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178758 CAAATCCATCTCCCATGTCAA pLKO.1 1370 CDS 100% 4.950 2.475 Y CHTF8 n/a
2 TRCN0000179148 GTTCTGTTAACCTCTGGGAAT pLKO.1 949 CDS 100% 4.050 2.025 Y CHTF8 n/a
3 TRCN0000180128 CAGCTTCTTTCTCACAGGCTT pLKO.1 1250 CDS 100% 2.640 1.320 Y CHTF8 n/a
4 TRCN0000179434 GCTCAAGTTCAAATGAGCCAT pLKO.1 2072 3UTR 100% 0.264 0.132 Y CHTF8 n/a
5 TRCN0000183356 GCCCATTGTTTCTTACTAGTT pLKO.1 2236 3UTR 100% 0.000 0.000 Y CHTF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12111 pDONR223 100% 8.3% 8.3% None 1_1440del n/a
2 ccsbBroad304_12111 pLX_304 0% 8.3% 8.3% V5 1_1440del n/a
3 TRCN0000478217 CCTCGCCACTGTCCTGTGGCCGGC pLX_317 100% 8.3% 8.3% V5 1_1440del n/a
Download CSV