Transcript: Human NM_001003712.2

Homo sapiens oxysterol binding protein like 8 (OSBPL8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
OSBPL8 (114882)
Length:
7158
CDS:
523..3066

Additional Resources:

NCBI RefSeq record:
NM_001003712.2
NBCI Gene record:
OSBPL8 (114882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146765 CAGAGTTCCATCGAATCTATA pLKO.1 2887 CDS 100% 13.200 18.480 N OSBPL8 n/a
2 TRCN0000281160 CAGAGTTCCATCGAATCTATA pLKO_005 2887 CDS 100% 13.200 18.480 N OSBPL8 n/a
3 TRCN0000150147 GCACGGTTAACTTTCTTGAAT pLKO.1 2059 CDS 100% 5.625 7.875 N OSBPL8 n/a
4 TRCN0000281157 GCACGGTTAACTTTCTTGAAT pLKO_005 2059 CDS 100% 5.625 7.875 N OSBPL8 n/a
5 TRCN0000147487 GAAGTGAAGCTCAATCAGTAA pLKO.1 2822 CDS 100% 4.950 3.465 N OSBPL8 n/a
6 TRCN0000281228 GAAGTGAAGCTCAATCAGTAA pLKO_005 2822 CDS 100% 4.950 3.465 N OSBPL8 n/a
7 TRCN0000148003 GATGGTGTTATTCAGACCAAA pLKO.1 2683 CDS 100% 4.950 3.465 N OSBPL8 n/a
8 TRCN0000147289 GTGACACAGATACATCAGAAA pLKO.1 1454 CDS 100% 4.950 3.465 N OSBPL8 n/a
9 TRCN0000281229 GTGACACAGATACATCAGAAA pLKO_005 1454 CDS 100% 4.950 3.465 N OSBPL8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04665 pDONR223 100% 95.2% 95.2% None 0_1ins126 n/a
2 ccsbBroad304_04665 pLX_304 0% 95.2% 95.2% V5 0_1ins126 n/a
3 TRCN0000465866 CCAGCAGTGCTCGCAGGGGAAGCC pLX_317 14.7% 95.2% 95.2% V5 0_1ins126 n/a
Download CSV