Transcript: Human NM_001003819.4

Homo sapiens TRIM6-TRIM34 readthrough (TRIM6-TRIM34), mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TRIM6-TRIM34 (445372)
Length:
3479
CDS:
262..2790

Additional Resources:

NCBI RefSeq record:
NM_001003819.4
NBCI Gene record:
TRIM6-TRIM34 (445372)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003819.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415234 AGTTATGAGAGATGCTTATTT pLKO_005 2937 3UTR 100% 15.000 7.500 Y TRIM34 n/a
2 TRCN0000153814 CCTTGTGGTTTCCCTTCTTTA pLKO.1 2874 3UTR 100% 13.200 6.600 Y TRIM6-TRIM34 n/a
3 TRCN0000034083 CAAGCCTGCATCACACCAAAT pLKO.1 451 CDS 100% 10.800 5.400 Y TRIM6 n/a
4 TRCN0000150702 CAAGTGATATCTGTGCCAATT pLKO.1 2287 CDS 100% 10.800 5.400 Y TRIM6-TRIM34 n/a
5 TRCN0000152377 GAGTTTAATCAGCTGCGAAAT pLKO.1 901 CDS 100% 10.800 5.400 Y TRIM6-TRIM34 n/a
6 TRCN0000154016 CCCTACAAAGCTGAGAAGTAT pLKO.1 1155 CDS 100% 5.625 2.813 Y TRIM6-TRIM34 n/a
7 TRCN0000005894 GCAGGACATGAGTGGAATCAT pLKO.1 2070 CDS 100% 5.625 2.813 Y TRIM34 n/a
8 TRCN0000005892 CGGAGGAAGTATTCAAGGAAT pLKO.1 1721 CDS 100% 4.950 2.475 Y TRIM34 n/a
9 TRCN0000010970 GCCTTCCCATTTATCCATGTT pLKO.1 3039 3UTR 100% 4.950 2.475 Y TRIM34 n/a
10 TRCN0000034081 GTCTCTAAAGAAGCTGAAGAA pLKO.1 783 CDS 100% 4.950 2.475 Y TRIM6 n/a
11 TRCN0000300451 GTCTCTAAAGAAGCTGAAGAA pLKO_005 783 CDS 100% 4.950 2.475 Y TRIM6 n/a
12 TRCN0000005895 GTGTGGTATCAGTTACTCATT pLKO.1 1497 CDS 100% 4.950 2.475 Y TRIM34 n/a
13 TRCN0000152646 GCTACAATGACTTCACCAGTA pLKO.1 340 CDS 100% 4.050 2.025 Y TRIM6-TRIM34 n/a
14 TRCN0000154765 GTACTGGTGGACATACGAGAA pLKO.1 358 CDS 100% 4.050 2.025 Y TRIM6-TRIM34 n/a
15 TRCN0000151526 CATTTGAACATCTACAGGCTA pLKO.1 1514 CDS 100% 2.640 1.320 Y TRIM6-TRIM34 n/a
16 TRCN0000005893 CGCCATATGAAGTATGTTGTT pLKO.1 2437 CDS 100% 0.000 0.000 Y TRIM34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003819.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05690 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05690 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477088 ATACACCGAAGCTAGGTACGCAAA pLX_317 15% 100% 100% V5 n/a
Download CSV