Transcript: Human NM_001003941.3

Homo sapiens oxoglutarate dehydrogenase (OGDH), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
OGDH (4967)
Length:
1693
CDS:
55..1338

Additional Resources:

NCBI RefSeq record:
NM_001003941.3
NBCI Gene record:
OGDH (4967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412481 TTCTGTCAATTCGATTCAAAG pLKO_005 1042 CDS 100% 10.800 15.120 N OGDH n/a
2 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1404 3UTR 100% 4.950 2.475 Y ERAP2 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1405 3UTR 100% 13.200 6.600 Y LIAS n/a
4 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1570 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15515 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15515 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479889 AACGTAAGATGCATCTGACTCGGC pLX_317 29.4% 100% 100% V5 n/a
Download CSV