Construct: ORF TRCN0000479889
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007587.1_s317c1
- Derived from:
- ccsbBroadEn_15515
- DNA Barcode:
- AACGTAAGATGCATCTGACTCGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OGDH (4967)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479889
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4967 | OGDH | oxoglutarate dehydrogenase | NM_001003941.3 | 100% | 100% | |
2 | human | 4967 | OGDH | oxoglutarate dehydrogenase | NM_002541.4 | 41% | 40% | (many diffs) |
3 | human | 4967 | OGDH | oxoglutarate dehydrogenase | XM_005249759.5 | 40.4% | 39.4% | (many diffs) |
4 | human | 4967 | OGDH | oxoglutarate dehydrogenase | XM_011515408.2 | 40.4% | 39.4% | (many diffs) |
5 | human | 4967 | OGDH | oxoglutarate dehydrogenase | NM_001363523.2 | 39.1% | 37.7% | (many diffs) |
6 | human | 4967 | OGDH | oxoglutarate dehydrogenase | NM_001165036.2 | 39.1% | 38.1% | (many diffs) |
7 | human | 4967 | OGDH | oxoglutarate dehydrogenase | XM_024446783.1 | 21% | 14.9% | (many diffs) |
8 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | NM_001252287.1 | 37.7% | 39% | (many diffs) |
9 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | NM_010956.4 | 37.7% | 39% | (many diffs) |
10 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | XM_006514585.2 | 37.7% | 39% | (many diffs) |
11 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | NM_001252282.1 | 37.2% | 38.4% | (many diffs) |
12 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | NM_001252288.1 | 36.2% | 37% | (many diffs) |
13 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | XM_006514586.3 | 36.2% | 37% | (many diffs) |
14 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | NM_001252283.1 | 36% | 36.7% | (many diffs) |
15 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | XM_006514582.2 | 36% | 36.7% | (many diffs) |
16 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | XM_006514583.3 | 36% | 36.7% | (many diffs) |
17 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | XM_006514584.3 | 36% | 36.7% | (many diffs) |
18 | mouse | 18293 | Ogdh | oxoglutarate (alpha-ketoglu... | XM_017314337.1 | 36% | 36.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1347
- ORF length:
- 1281
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tcatttaagg acttgtgctg ctaagttgag gccattgacg gcttcccaga 121 ctgttaagac attttcacaa aacagaccag cagcagctag gacatttcaa cagattcggt 181 gctattctgc acctgttgct gctgagccct ttctcagtgg gactagttcg aactatgtgg 241 aggagatgta ctgtgcttgg ctggaaaacc ccaaaagtgt acataagtca tgggacattt 301 tttttcgcaa cacgaatgcc ggagccccac cgggcactgc ctaccagagt ccccttcccc 361 tgagccgagg ctccctggct gctgtggccc atgcacagtc cctggtagaa gcacagccca 421 acgtggacaa gctcgtggag gaccacctgg cagtgcagtc gctcatcagg gcatatcaga 481 tacgagggca ccatgtagca cagctggacc ccctggggat tttggatgct gatctggact 541 cctccgtgcc cgctgacatt atctcatcca cagacaaact tgggttctat ggcctggatg 601 agtctgacct cgacaaggtc ttccacttgc ccaccaccac tttcatcggg ggacaggaat 661 cagcacttcc tctgcgggag atcatccgtc ggctggagat ggcctactgc cagcatattg 721 gggtggagtt catgttcatc aatgacctgg agcagtgcca gtggatccgg cagaagtttg 781 agacccctgg gatcatgcag ttcacaaatg aggagaaacg gaccctgctg gccaggcttg 841 tgcggtccac caggtttgag gagttcctac agcggaagtg gtcctctgag aagcgctttg 901 gtctagaagg ctgcgaggta ctgatccctg ccctcaagac catcattgac aagtctagtg 961 agaatggcgt ggacTACGTG ATCATGGGCA TGCCACACAG AGGGCGGCTG AACGTGCTTG 1021 CAAATGTCAT CAGGAAGGAG CTGGAACAGA TCTTCTGTCA ATTCGATTCA AAGCTGGAGG 1081 CAGCTGATGA GGGCTCCGGA GATGTGAAGT ACCACCTGGG CATGTATCAC CGCAGGATCA 1141 ATCGTGTCAC CGACAGGAAC ATTACCTTGT CCTTGGTGGC CAACCCTTCC CACCTTGAGG 1201 CCGCTGACCC CGTGGTGATG GGCAAGACCA AAGCCGAACA GTTTTACTGT GGCGACACTG 1261 AAGGGAAAAA GGTAAGGCCC AGAGAGAGGC GTGCAAGGCA GATCGTCAAG GCCCCATGTT 1321 CCAGCATGGA GTTCCGCTCA CCAACATACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1381 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1441 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAACGTAAG 1501 ATGCATCTGA CTCGGCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1561 aagatt