Transcript: Human NM_001004297.3

Homo sapiens olfactory receptor family 13 subfamily A member 1 (OR13A1), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
OR13A1 (79290)
Length:
2082
CDS:
310..1296

Additional Resources:

NCBI RefSeq record:
NM_001004297.3
NBCI Gene record:
OR13A1 (79290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004297.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000584386 AGAATACCGGGTGTTCTTATT pLKO_005 426 CDS 100% 13.200 18.480 N OR13A1 n/a
2 TRCN0000062954 GCTGTCTTCTACGCCTACATA pLKO.1 1123 CDS 100% 5.625 7.875 N OR13A1 n/a
3 TRCN0000062955 CCTCACAGGTAATGTCCTCAT pLKO.1 477 CDS 100% 4.050 2.835 N OR13A1 n/a
4 TRCN0000062957 CGGCATAGTGAACTTCCTGAT pLKO.1 981 CDS 100% 4.050 2.835 N OR13A1 n/a
5 TRCN0000062956 GCTGCATTACAGCAGCATGAT pLKO.1 750 CDS 100% 0.495 0.347 N OR13A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004297.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08926 pDONR223 100% 99.8% 100% None 150C>A n/a
2 ccsbBroad304_08926 pLX_304 0% 99.8% 100% V5 150C>A n/a
3 TRCN0000475929 GTTATCACTATCGGTAAATGCCTC pLX_317 32.3% 99.8% 100% V5 150C>A n/a
4 TRCN0000489067 GTTACATCGATAACTAGACCGGTC pLX_317 34.4% 94.2% 94.2% V5 (not translated due to prior stop codon) 1_57del n/a
5 TRCN0000491552 TCAGTGGTGGGACCCTCATGATGT pLX_317 32.1% 94.1% 93.9% V5 1_57del;984_985insG n/a
Download CSV