Transcript: Human NM_001004325.2

Homo sapiens keratin associated protein 5-2 (KRTAP5-2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KRTAP5-2 (440021)
Length:
1118
CDS:
45..578

Additional Resources:

NCBI RefSeq record:
NM_001004325.2
NBCI Gene record:
KRTAP5-2 (440021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056444 CCAGATGTTATGTGCCTGTCT pLKO.1 205 CDS 100% 2.640 1.848 N KRTAP5-2 n/a
2 TRCN0000056443 GTTTGGTGAAAGCATTTCTTA pLKO.1 610 3UTR 100% 5.625 3.375 N KRTAP5-2 n/a
3 TRCN0000056445 CCAACTGTTGTGTCCCTGTGT pLKO.1 538 CDS 100% 2.640 1.584 N KRTAP5-2 n/a
4 TRCN0000056447 CCAGCTGTTGTAAGCCCTGTT pLKO.1 391 CDS 100% 4.050 2.025 Y KRTAP5-2 n/a
5 TRCN0000056446 CCCTGTGTGCTGCCAGTGTAA pLKO.1 551 CDS 100% 1.650 0.825 Y KRTAP5-2 n/a
6 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 451 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05666 pDONR223 100% 67.4% 66.1% None (many diffs) n/a
2 ccsbBroad304_05666 pLX_304 0% 67.4% 66.1% V5 (many diffs) n/a
3 TRCN0000475440 ACCAAGCTTTGGTAAGATGTTTGA pLX_317 10.7% 67.4% 66.1% V5 (many diffs) n/a
4 ccsbBroadEn_00915 pDONR223 100% 67% 58.5% None (many diffs) n/a
5 ccsbBroad304_00915 pLX_304 0% 67% 58.5% V5 (many diffs) n/a
6 TRCN0000473555 AATCGCAAATACTACCTAGATCGT pLX_317 94.8% 67% 58.5% V5 (many diffs) n/a
Download CSV