Transcript: Human NM_001004462.1

Homo sapiens olfactory receptor family 10 subfamily G member 4 (OR10G4), mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
OR10G4 (390264)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_001004462.1
NBCI Gene record:
OR10G4 (390264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187757 GTTGTCATTTATCTGAGGCCA pLKO.1 763 CDS 100% 0.660 0.462 N OR10G4 n/a
2 TRCN0000188949 GCCAACGTGATGGTCATCTTT pLKO.1 577 CDS 100% 5.625 3.375 N OR10G4 n/a
3 TRCN0000203764 CTTTGTGGACATTGGGATAGT pLKO.1 594 CDS 100% 4.950 2.970 N OR10G4 n/a
4 TRCN0000584708 CTGCGTGGCTCAGCTCTATTT pLKO_005 285 CDS 100% 13.200 6.600 Y OR10G7 n/a
5 TRCN0000188408 CTCACCAACCTGTCCTTCATT pLKO.1 181 CDS 100% 5.625 2.813 Y OR10G7 n/a
6 TRCN0000187661 GTGGTCCTTTGCTTCTTTGTT pLKO.1 736 CDS 100% 5.625 2.813 Y OR10G4 n/a
7 TRCN0000188567 CAACCAGATCCAGCACTACTT pLKO.1 510 CDS 100% 4.950 2.475 Y OR10G4 n/a
8 TRCN0000194262 CAACCTGTCCTTCATTGACAT pLKO.1 186 CDS 100% 4.950 2.475 Y OR10G9 n/a
9 TRCN0000187345 CATGTCCTATGATCGCTACTT pLKO.1 348 CDS 100% 4.950 2.475 Y OR10G9 n/a
10 TRCN0000204638 GTCCTGATAGTGCTGTCCTAT pLKO.1 631 CDS 100% 4.950 2.475 Y OR10G7 n/a
11 TRCN0000187756 GTGTTTCCTCTACACAGTCAT pLKO.1 330 CDS 100% 4.950 2.475 Y OR10G9 n/a
12 TRCN0000203982 GATGGTCATCTTTGTGGACAT pLKO.1 585 CDS 100% 4.050 2.025 Y OR10G9 n/a
13 TRCN0000203734 CCAGACCATATTGACTTTCCA pLKO.1 471 CDS 100% 3.000 1.500 Y OR10G9 n/a
14 TRCN0000194273 CATGTACTACTTCCTCACCAA pLKO.1 168 CDS 100% 2.640 1.320 Y OR10G7 n/a
15 TRCN0000187716 GTCCTTCATTGACATGTGGTT pLKO.1 192 CDS 100% 2.640 1.320 Y OR10G4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09848 pDONR223 100% 92.2% 87.1% None (many diffs) n/a
2 ccsbBroad304_09848 pLX_304 0% 92.2% 87.1% V5 (many diffs) n/a
3 TRCN0000480124 GCGCCAATATGCCTCCGTCAACTC pLX_317 38.8% 92.2% 87.1% V5 (many diffs) n/a
Download CSV