Transcript: Human NM_001005612.3

Homo sapiens ectodysplasin A (EDA), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
EDA (1896)
Length:
5220
CDS:
197..1357

Additional Resources:

NCBI RefSeq record:
NM_001005612.3
NBCI Gene record:
EDA (1896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362583 TAGGCGTGTTCGCCGCAATAA pLKO_005 649 CDS 100% 13.200 18.480 N Eda n/a
2 TRCN0000058803 CCACAGAACTTGTGGCCTTTA pLKO.1 3640 3UTR 100% 1.080 1.512 N EDA n/a
3 TRCN0000363273 ACGGCACCTACTTCATCTATA pLKO_005 1080 CDS 100% 13.200 9.240 N EDA n/a
4 TRCN0000363244 GGAGCAGATGGCCCAGTTAAA pLKO_005 689 CDS 100% 13.200 9.240 N EDA n/a
5 TRCN0000066200 CCAACTACAACACTTGCTATA pLKO.1 1203 CDS 100% 10.800 7.560 N Eda n/a
6 TRCN0000363248 GACTGGTCTCGCATCACTATG pLKO_005 1004 CDS 100% 10.800 7.560 N EDA n/a
7 TRCN0000058806 CTGCTCTTCCTGGGTTTCTTT pLKO.1 317 CDS 100% 5.625 3.938 N EDA n/a
8 TRCN0000066202 GACGGCACCTACTTCATCTAT pLKO.1 1079 CDS 100% 5.625 3.938 N Eda n/a
9 TRCN0000058805 CCCAAGGTGTTTAAGCTACAT pLKO.1 1028 CDS 100% 4.950 3.465 N EDA n/a
10 TRCN0000058804 CGCTGACATCTCCATCAACAT pLKO.1 1279 CDS 100% 4.950 3.465 N EDA n/a
11 TRCN0000058807 GCAATTCAAGTCAAGAATGAT pLKO.1 971 CDS 100% 5.625 3.938 N EDA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00475 pDONR223 100% 98.7% 98.7% None 792_793insGATCTTTCA;909_910insGTAGAA n/a
2 ccsbBroad304_00475 pLX_304 0% 98.7% 98.7% V5 792_793insGATCTTTCA;909_910insGTAGAA n/a
3 TRCN0000469272 GGAGTCGTGAAACAACACGTTTGC pLX_317 32.6% 98.7% 98.7% V5 792_793insGATCTTTCA;909_910insGTAGAA n/a
Download CSV