Transcript: Mouse NM_001005863.2

Mus musculus mitochondrial tumor suppressor 1 (Mtus1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mtus1 (102103)
Length:
6554
CDS:
410..4042

Additional Resources:

NCBI RefSeq record:
NM_001005863.2
NBCI Gene record:
Mtus1 (102103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042454 CGGAGCCATTTGCACAGATAA pLKO.1 1639 CDS 100% 13.200 18.480 N Mtus1 n/a
2 TRCN0000042457 CGCAAGTTACAACTCATTCTA pLKO.1 2148 CDS 100% 5.625 3.938 N Mtus1 n/a
3 TRCN0000042455 GCTGTGTTAGAGATCAAGAAT pLKO.1 3662 CDS 100% 5.625 3.938 N Mtus1 n/a
4 TRCN0000042456 CCCAATTAACAAGACACACAA pLKO.1 2092 CDS 100% 4.950 3.465 N Mtus1 n/a
5 TRCN0000042453 GCCTGTATTAACCAAGTCATA pLKO.1 4555 3UTR 100% 4.950 3.465 N Mtus1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12354 pDONR223 100% 16.9% 18.2% None (many diffs) n/a
2 ccsbBroad304_12354 pLX_304 0% 16.9% 18.2% V5 (many diffs) n/a
3 TRCN0000480502 TCTGGCAGATAGACTCTTAATTTT pLX_317 57.9% 16.9% 18.2% V5 (many diffs) n/a
Download CSV