Transcript: Human NM_001006619.1

Homo sapiens MAPK associated protein 1 (MAPKAP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MAPKAP1 (79109)
Length:
3254
CDS:
334..1761

Additional Resources:

NCBI RefSeq record:
NM_001006619.1
NBCI Gene record:
MAPKAP1 (79109)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001006619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003150 CAGTCGATATTACCTCAAGTT pLKO.1 539 CDS 100% 4.950 6.930 N MAPKAP1 n/a
2 TRCN0000277726 CAGTCGATATTACCTCAAGTT pLKO_005 539 CDS 100% 4.950 6.930 N MAPKAP1 n/a
3 TRCN0000003151 CTAAGCAATCACGACTATAAA pLKO.1 1564 CDS 100% 15.000 12.000 N MAPKAP1 n/a
4 TRCN0000277788 CTAAGCAATCACGACTATAAA pLKO_005 1564 CDS 100% 15.000 12.000 N MAPKAP1 n/a
5 TRCN0000003152 GTTGGGACTTTGGTATTAGAA pLKO.1 557 CDS 100% 5.625 3.938 N MAPKAP1 n/a
6 TRCN0000277784 GTTGGGACTTTGGTATTAGAA pLKO_005 557 CDS 100% 5.625 3.938 N MAPKAP1 n/a
7 TRCN0000077478 CCCATATTGAACAGGCAGATT pLKO.1 2246 3UTR 100% 4.950 3.465 N Mapkap1 n/a
8 TRCN0000301432 CCCATATTGAACAGGCAGATT pLKO_005 2246 3UTR 100% 4.950 3.465 N Mapkap1 n/a
9 TRCN0000077480 GCCCATTCATAAGTTTGGCTT pLKO.1 1089 CDS 100% 2.640 1.848 N Mapkap1 n/a
10 TRCN0000301443 GCCCATTCATAAGTTTGGCTT pLKO_005 1089 CDS 100% 2.640 1.848 N Mapkap1 n/a
11 TRCN0000010762 AGCCACCTTCAATGCCTGCCA pLKO.1 2033 3UTR 100% 0.220 0.154 N MAPKAP1 n/a
12 TRCN0000277785 AGCCACCTTCAATGCCTGCCA pLKO_005 2033 3UTR 100% 0.220 0.154 N MAPKAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001006619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14258 pDONR223 100% 93.3% .8% None (many diffs) n/a
2 ccsbBroad304_14258 pLX_304 0% 93.3% .8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000465275 CTGGCGAGGCTTCTGCTGCCTTGG pLX_317 8.1% 93.3% .8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV