Transcript: Human NM_001006943.3

Homo sapiens EPH receptor A8 (EPHA8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
EPHA8 (2046)
Length:
1877
CDS:
148..1635

Additional Resources:

NCBI RefSeq record:
NM_001006943.3
NBCI Gene record:
EPHA8 (2046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001006943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001348 CTATAAGAAGTGCCCTGCCAT pLKO.1 747 CDS 100% 2.640 3.696 N EPHA8 n/a
2 TRCN0000001347 GCGAAGTGAATTTGCTGGACA pLKO.1 236 CDS 100% 2.640 3.696 N EPHA8 n/a
3 TRCN0000195445 CAGTGTGAATGGGACATCAGT pLKO.1 1158 CDS 100% 3.000 2.400 N EPHA8 n/a
4 TRCN0000218057 TCTATGCTGAGATCAAGTTTA pLKO_005 437 CDS 100% 13.200 9.240 N EPHA8 n/a
5 TRCN0000230030 TCTCTCTCCGCATCTACTATA pLKO_005 731 CDS 100% 13.200 9.240 N EPHA8 n/a
6 TRCN0000230031 GCAGTGACATCACCTACAATG pLKO_005 1217 CDS 100% 10.800 7.560 N EPHA8 n/a
7 TRCN0000195591 CGCAGTGACATCACCTACAAT pLKO.1 1216 CDS 100% 5.625 3.938 N EPHA8 n/a
8 TRCN0000356087 ACCAGGTTTGCAACGTCATGA pLKO_005 356 CDS 100% 4.950 3.465 N EPHA8 n/a
9 TRCN0000377266 TTCTGGATCGAGGCCGTCAAT pLKO_005 1375 CDS 100% 4.950 3.465 N EPHA8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001006943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06170 pDONR223 100% 99.9% 100% None 6C>T n/a
2 ccsbBroad304_06170 pLX_304 0% 99.9% 100% V5 6C>T n/a
3 TRCN0000470862 CCTTATTTCTCCCTATTGCCCGTC pLX_317 27.7% 99.9% 100% V5 6C>T n/a
Download CSV