Transcript: Human NM_001007531.3

Homo sapiens NFKB activating protein like (NKAPL), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
NKAPL (222698)
Length:
1662
CDS:
76..1284

Additional Resources:

NCBI RefSeq record:
NM_001007531.3
NBCI Gene record:
NKAPL (222698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136240 GATTCCAACTCGGAAGAACAT pLKO.1 580 CDS 100% 4.950 6.930 N NKAPL n/a
2 TRCN0000137594 CCTCAGCTAGATTCTGACGAA pLKO.1 505 CDS 100% 2.640 3.696 N NKAPL n/a
3 TRCN0000134222 GAGACGAAAGAGAGAAAGTAA pLKO.1 1203 CDS 100% 5.625 3.938 N NKAPL n/a
4 TRCN0000135874 GATGAAGAAGAGGTAACGCAT pLKO.1 541 CDS 100% 2.640 1.848 N NKAPL n/a
5 TRCN0000135350 GAAGACCAGTCGTTCAAGAAA pLKO.1 609 CDS 100% 5.625 3.375 N NKAPL n/a
6 TRCN0000135451 GAGGTGAAATTGGGTTGACAA pLKO.1 1037 CDS 100% 4.950 2.970 N NKAPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09885 pDONR223 100% 99.8% 99.5% None 287A>G;1193A>G n/a
2 ccsbBroad304_09885 pLX_304 0% 99.8% 99.5% V5 287A>G;1193A>G n/a
3 TRCN0000474338 ATCTTACGACCGAGCGGCCACCGG pLX_317 35.6% 99.8% 99.5% V5 287A>G;1193A>G n/a
Download CSV