Transcript: Human NM_001007537.2

Homo sapiens C1q and TNF related 9B (C1QTNF9B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
C1QTNF9B (387911)
Length:
1229
CDS:
21..1022

Additional Resources:

NCBI RefSeq record:
NM_001007537.2
NBCI Gene record:
C1QTNF9B (387911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146291 CTTCAGATGTGCCCATTAAAT pLKO.1 667 CDS 100% 15.000 9.000 N C1QTNF9 n/a
2 TRCN0000183677 GATGTGCCCATTAAATTTGAT pLKO.1 672 CDS 100% 5.625 3.375 N C1QTNF9B n/a
3 TRCN0000179796 CAGGAATGTTCAGGTGTCTTT pLKO.1 797 CDS 100% 4.950 2.970 N C1QTNF9B n/a
4 TRCN0000371530 CAGCTTGGGATGAACTTATTC pLKO_005 1064 3UTR 100% 13.200 6.600 Y C1QTNF9 n/a
5 TRCN0000439216 GGAAATTCACGTGCCACATTG pLKO_005 736 CDS 100% 10.800 5.400 Y C1QTNF9B n/a
6 TRCN0000149546 GAAATCTGCACAGGGAACATA pLKO.1 51 CDS 100% 5.625 2.813 Y C1QTNF9 n/a
7 TRCN0000149169 GAGAGGTTCAATGGCTTGTTT pLKO.1 945 CDS 100% 5.625 2.813 Y C1QTNF9 n/a
8 TRCN0000184344 GAAAGGAGATCGAGGAGAGAA pLKO.1 569 CDS 100% 4.950 2.475 Y C1QTNF9B n/a
9 TRCN0000146678 CTATTACTTCACCTACCACAT pLKO.1 764 CDS 100% 4.050 2.025 Y C1QTNF9 n/a
10 TRCN0000146525 CACAGGGAACATAAACTCACA pLKO.1 59 CDS 100% 2.640 1.320 Y C1QTNF9 n/a
11 TRCN0000178839 CATTGAAATCTGCACAGGGAA pLKO.1 47 CDS 100% 2.640 1.320 Y C1QTNF9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10091 pDONR223 100% 99.8% 100% None 687T>C n/a
2 ccsbBroad304_10091 pLX_304 0% 99.8% 100% V5 687T>C n/a
3 TRCN0000476007 AGTCCAAGTTCCCATTGGACTTCT pLX_317 35.8% 99.8% 100% V5 687T>C n/a
4 ccsbBroadEn_10005 pDONR223 100% 99% 97.8% None (many diffs) n/a
5 ccsbBroad304_10005 pLX_304 0% 99% 97.8% V5 (many diffs) n/a
6 TRCN0000473757 ATCTTAGTATATGTCATACGGTCC pLX_317 48.2% 99% 97.8% V5 (many diffs) n/a
Download CSV