Transcript: Mouse NM_001007570.2

Mus musculus solute carrier family 25, member 42 (Slc25a42), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc25a42 (73095)
Length:
3181
CDS:
87..1043

Additional Resources:

NCBI RefSeq record:
NM_001007570.2
NBCI Gene record:
Slc25a42 (73095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001007570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110847 CTTCACCACTTTCGACCTCAT pLKO.1 992 CDS 100% 4.050 5.670 N Slc25a42 n/a
2 TRCN0000110848 ACACGAAGAATACAAGCGCAT pLKO.1 416 CDS 100% 2.160 3.024 N Slc25a42 n/a
3 TRCN0000110845 GCAGTCTTTGTTCATTCTATA pLKO.1 2630 3UTR 100% 13.200 9.240 N Slc25a42 n/a
4 TRCN0000110849 CAGCAACATCTTTCATGTCTT pLKO.1 587 CDS 100% 4.950 3.465 N Slc25a42 n/a
5 TRCN0000144548 CAGCAACATCTTTCATGTCTT pLKO.1 587 CDS 100% 4.950 3.465 N SLC25A42 n/a
6 TRCN0000145296 GTACAGCAACATCTTTCATGT pLKO.1 584 CDS 100% 4.950 3.465 N SLC25A42 n/a
7 TRCN0000110846 GCCTAAGGAAATGTACAGCAA pLKO.1 572 CDS 100% 2.640 1.848 N Slc25a42 n/a
8 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 2363 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09964 pDONR223 100% 85.6% 91.5% None (many diffs) n/a
2 ccsbBroad304_09964 pLX_304 0% 85.6% 91.5% V5 (many diffs) n/a
3 TRCN0000477065 TTGGAGACCAACTTCGTAATGTTG pLX_317 36.7% 85.6% 91.5% V5 (many diffs) n/a
Download CSV