Transcript: Human NM_001008215.3

Homo sapiens cytochrome c oxidase assembly factor 5 (COA5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
COA5 (493753)
Length:
1770
CDS:
108..332

Additional Resources:

NCBI RefSeq record:
NM_001008215.3
NBCI Gene record:
COA5 (493753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162207 CAACTCTTTGAAGTACGCATT pLKO.1 248 CDS 100% 4.050 5.670 N COA5 n/a
2 TRCN0000163795 GCAACTCTTTGAAGTACGCAT pLKO.1 247 CDS 100% 2.640 3.696 N COA5 n/a
3 TRCN0000161976 GCTCTGATTCACTGAAGTAAT pLKO.1 827 3UTR 100% 13.200 9.240 N COA5 n/a
4 TRCN0000164792 CCTATCCAGAAGGTGTCTGTT pLKO.1 705 3UTR 100% 4.950 3.465 N COA5 n/a
5 TRCN0000163409 GCAGTGTTTGAAGGAAGGATA pLKO.1 224 CDS 100% 4.950 3.465 N COA5 n/a
6 TRCN0000163444 GTTTGAAGGAAGGATACTGCA pLKO.1 229 CDS 100% 2.640 1.848 N COA5 n/a
7 TRCN0000158799 GCACTGAAGAATTACAAAGAA pLKO.1 1407 3UTR 100% 5.625 2.813 Y COA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05693 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05693 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473100 AAAGATTGTAGTGCCATTGTCTTT pLX_317 100% 100% 100% V5 n/a
Download CSV