Transcript: Human NM_001008239.2

Homo sapiens chromosome 18 open reading frame 25 (C18orf25), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
C18orf25 (147339)
Length:
5290
CDS:
380..1411

Additional Resources:

NCBI RefSeq record:
NM_001008239.2
NBCI Gene record:
C18orf25 (147339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330523 CATATCAGTCAGGTCCTTATT pLKO_005 1856 3UTR 100% 13.200 18.480 N C18orf25 n/a
2 TRCN0000130751 GATGAGGATAGCAGGCGTAAA pLKO.1 1379 CDS 100% 10.800 15.120 N C18orf25 n/a
3 TRCN0000330522 GATGAGGATAGCAGGCGTAAA pLKO_005 1379 CDS 100% 10.800 15.120 N C18orf25 n/a
4 TRCN0000127918 CAGTATGTTAGCACCAGGCAA pLKO.1 1286 CDS 100% 2.640 3.696 N C18orf25 n/a
5 TRCN0000127876 GCCGAGTTTATGAGAGTGACT pLKO.1 624 CDS 100% 2.640 3.696 N C18orf25 n/a
6 TRCN0000130629 CCTGGCTGATTCAGATACGTT pLKO.1 685 CDS 100% 3.000 2.400 N C18orf25 n/a
7 TRCN0000330520 CCTGGCTGATTCAGATACGTT pLKO_005 685 CDS 100% 3.000 2.400 N C18orf25 n/a
8 TRCN0000130621 CAGGACAGTAGTACCAGTGAT pLKO.1 983 CDS 100% 4.950 3.465 N C18orf25 n/a
9 TRCN0000330521 CAGGACAGTAGTACCAGTGAT pLKO_005 983 CDS 100% 4.950 3.465 N C18orf25 n/a
10 TRCN0000128008 GATACGTTGTCTTCCGCAGAA pLKO.1 698 CDS 100% 4.050 2.835 N C18orf25 n/a
11 TRCN0000128966 GAAGAACTCATTGAGTCCGAA pLKO.1 410 CDS 100% 2.640 1.848 N C18orf25 n/a
12 TRCN0000201336 GAGAGTGACTCCTCTAATCAT pLKO.1 635 CDS 100% 5.625 3.938 N 8030462N17Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09644 pDONR223 100% 84.7% 84.4% None 6G>T;712_713ins183;1015C>A n/a
2 ccsbBroad304_09644 pLX_304 0% 84.7% 84.4% V5 6G>T;712_713ins183;1015C>A n/a
3 TRCN0000480506 ACTTAACCGTCAGCACACAATTTC pLX_317 37.5% 84.7% 84.4% V5 6G>T;712_713ins183;1015C>A n/a
Download CSV