Transcript: Mouse NM_001010836.3

Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 13 like (Ppp1r13l), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r13l (333654)
Length:
3130
CDS:
128..2602

Additional Resources:

NCBI RefSeq record:
NM_001010836.3
NBCI Gene record:
Ppp1r13l (333654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001010836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087800 CCACGCAATTACAAGGTGTCT pLKO.1 1052 CDS 100% 2.640 3.696 N Ppp1r13l n/a
2 TRCN0000087801 GCGCAACTACTTCGGGCTCTT pLKO.1 2548 CDS 100% 1.350 1.890 N Ppp1r13l n/a
3 TRCN0000087799 CAAGAAACAATACCAACAGAT pLKO.1 1732 CDS 100% 4.950 3.465 N Ppp1r13l n/a
4 TRCN0000087802 ACCCACAAGAAACAATACCAA pLKO.1 1727 CDS 100% 3.000 2.100 N Ppp1r13l n/a
5 TRCN0000087798 CCCAGACTGAAGATTAGGAAA pLKO.1 2752 3UTR 100% 4.950 3.465 N Ppp1r13l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07691 pDONR223 100% 82.3% 88.1% None (many diffs) n/a
2 ccsbBroad304_07691 pLX_304 0% 82.3% 88.1% V5 (many diffs) n/a
3 TRCN0000479632 TGCTTTCCACCTATATGGGCGGCA pLX_317 12.1% 82.3% 88.1% V5 (many diffs) n/a
Download CSV