Transcript: Human NM_001012418.5

Homo sapiens myosin light chain kinase family member 4 (MYLK4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MYLK4 (340156)
Length:
5754
CDS:
300..1466

Additional Resources:

NCBI RefSeq record:
NM_001012418.5
NBCI Gene record:
MYLK4 (340156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012418.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360051 ATCGATGAGAGCTACAATTTG pLKO_005 876 CDS 100% 13.200 18.480 N MYLK4 n/a
2 TRCN0000363326 CATCGCCTATATGCTACTTAG pLKO_005 1172 CDS 100% 10.800 15.120 N MYLK4 n/a
3 TRCN0000037448 GTGTGTGAATCGGGATGCTAA pLKO.1 1001 CDS 100% 4.950 6.930 N MYLK4 n/a
4 TRCN0000037447 CTTCGAGTCTAAGAACGACAT pLKO.1 806 CDS 100% 4.050 5.670 N MYLK4 n/a
5 TRCN0000199509 GCGAACCTCATCCAGCTGTAC pLKO.1 780 CDS 100% 1.350 1.890 N MYLK4 n/a
6 TRCN0000363320 AGGAGAAGAGTTGGCGAATAA pLKO_005 1330 CDS 100% 13.200 9.240 N MYLK4 n/a
7 TRCN0000199590 GCCAAGGAGTTCATCTCTAAG pLKO.1 1299 CDS 100% 10.800 7.560 N MYLK4 n/a
8 TRCN0000037446 CAGCTTCTATACTGTGAGCAA pLKO.1 602 CDS 100% 2.640 1.848 N MYLK4 n/a
9 TRCN0000037444 CCTATATGCTACTTAGCGGTT pLKO.1 1177 CDS 100% 2.160 1.512 N MYLK4 n/a
10 TRCN0000037445 CCAGGACTTTGTGACCAAATA pLKO.1 1445 CDS 100% 13.200 7.920 N MYLK4 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3460 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012418.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10023 pDONR223 100% 99.9% 99.7% None 148G>A n/a
2 ccsbBroad304_10023 pLX_304 0% 99.9% 99.7% V5 148G>A n/a
3 TRCN0000468726 CAAAGAGTATTCCATGTAGACAAG pLX_317 32.2% 99.9% 99.7% V5 148G>A n/a
4 ccsbBroadEn_15305 pDONR223 100% 98.4% 30.9% None (many diffs) n/a
Download CSV