Transcript: Human NM_001012456.1

Homo sapiens SEC61 translocon gamma subunit (SEC61G), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SEC61G (23480)
Length:
480
CDS:
92..298

Additional Resources:

NCBI RefSeq record:
NM_001012456.1
NBCI Gene record:
SEC61G (23480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005537 GACTCCATTCGGCTGGTTAAA pLKO.1 140 CDS 100% 13.200 18.480 N SEC61G n/a
2 TRCN0000380509 TTGCTATAATGGGATTCATTG pLKO_005 222 CDS 100% 10.800 15.120 N SEC61G n/a
3 TRCN0000273511 AGCCAAGTCGGCAGTTTGTAA pLKO_005 117 CDS 100% 5.625 7.875 N SEC61G n/a
4 TRCN0000005535 GATGCACTAAACCTGATAGAA pLKO.1 162 CDS 100% 5.625 4.500 N SEC61G n/a
5 TRCN0000005538 CATTGGCTTCTTTGTGAAATT pLKO.1 238 CDS 100% 13.200 9.240 N SEC61G n/a
6 TRCN0000273512 TGTTGGTGGCTGAATACATTT pLKO_005 286 CDS 100% 13.200 9.240 N SEC61G n/a
7 TRCN0000381660 GGACTCCATTCGGCTGGTTAA pLKO_005 139 CDS 100% 10.800 7.560 N SEC61G n/a
8 TRCN0000380216 ATGCACTAAACCTGATAGAAA pLKO_005 163 CDS 100% 5.625 3.938 N SEC61G n/a
9 TRCN0000005534 ATCTTAGAGATTGGTGAACAA pLKO.1 323 3UTR 100% 4.950 3.465 N SEC61G n/a
10 TRCN0000273510 ATCTTAGAGATTGGTGAACAA pLKO_005 323 3UTR 100% 4.950 3.465 N SEC61G n/a
11 TRCN0000273514 ATTCCAGAAGATTGCCATGGC pLKO_005 187 CDS 100% 2.160 1.512 N SEC61G n/a
12 TRCN0000005536 CAGCAATAGGATTTGCTATAA pLKO.1 210 CDS 100% 1.320 0.924 N SEC61G n/a
13 TRCN0000273571 CAGCAATAGGATTTGCTATAA pLKO_005 210 CDS 100% 1.320 0.924 N SEC61G n/a
14 TRCN0000382085 TTGCCATGGCAACAGCAATAG pLKO_005 198 CDS 100% 10.800 6.480 N SEC61G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02776 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02776 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466863 AATTTTGGCGTTCCAACTTCGCGC pLX_317 100% 100% 100% V5 n/a
Download CSV