Transcript: Human NM_001012709.1

Homo sapiens keratin associated protein 5-4 (KRTAP5-4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Homo sapiens (human)
Gene:
KRTAP5-4 (387267)
Length:
1359
CDS:
46..912

Additional Resources:

NCBI RefSeq record:
NM_001012709.1
NBCI Gene record:
KRTAP5-4 (387267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165148 GAGTCCTGCTAATCCTGTCTT pLKO.1 936 3UTR 100% 4.950 6.930 N KRTAP5-4 n/a
2 TRCN0000158415 CATTGTCTCTCCTAACAAATT pLKO.1 1080 3UTR 100% 13.200 9.240 N KRTAP5-4 n/a
3 TRCN0000160554 CCATTGTCTCTCCTAACAAAT pLKO.1 1079 3UTR 100% 13.200 9.240 N KRTAP5-4 n/a
4 TRCN0000162694 CTGCTAATCCTGTCTTCCAAA pLKO.1 941 3UTR 100% 4.950 3.465 N KRTAP5-4 n/a
5 TRCN0000165715 CCTCATGTGAGTCCTGCTAAT pLKO.1 928 3UTR 100% 10.800 6.480 N KRTAP5-4 n/a
6 TRCN0000166301 CCTAAGAAGAGTCCACCCTAA pLKO.1 1051 3UTR 100% 4.050 2.025 Y KRTAP5-4 n/a
7 TRCN0000254751 TGCCAGTCCAGCTGCTGTAAG pLKO_005 691 CDS 100% 3.600 1.800 Y KRTAP5-5 n/a
8 TRCN0000056446 CCCTGTGTGCTGCCAGTGTAA pLKO.1 885 CDS 100% 1.650 0.825 Y KRTAP5-2 n/a
9 TRCN0000254464 TGTGCCCATCTGCTGCTGCAA pLKO_005 195 CDS 100% 0.880 0.440 Y KRTAP5-6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00915 pDONR223 100% 49.3% 49.3% None (many diffs) n/a
2 ccsbBroad304_00915 pLX_304 0% 49.3% 49.3% V5 (many diffs) n/a
3 TRCN0000473555 AATCGCAAATACTACCTAGATCGT pLX_317 94.8% 49.3% 49.3% V5 (many diffs) n/a
4 ccsbBroadEn_05666 pDONR223 100% 41.3% 43.4% None (many diffs) n/a
5 ccsbBroad304_05666 pLX_304 0% 41.3% 43.4% V5 (many diffs) n/a
6 TRCN0000475440 ACCAAGCTTTGGTAAGATGTTTGA pLX_317 10.7% 41.3% 43.4% V5 (many diffs) n/a
Download CSV