Transcript: Human NM_001012710.2

Homo sapiens keratin associated protein 5-10 (KRTAP5-10), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KRTAP5-10 (387273)
Length:
1173
CDS:
26..634

Additional Resources:

NCBI RefSeq record:
NM_001012710.2
NBCI Gene record:
KRTAP5-10 (387273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254809 TAATTCATCCCACGCATCCTC pLKO_005 701 3UTR 100% 2.640 3.696 N KRTAP5-10 n/a
2 TRCN0000267501 GTTATGATTTCCCTGAATTAA pLKO_005 683 3UTR 100% 15.000 10.500 N KRTAP5-10 n/a
3 TRCN0000254806 CCCTGAATTAATTCATCCCAC pLKO_005 693 3UTR 100% 2.160 1.512 N KRTAP5-10 n/a
4 TRCN0000254807 GGTGAAAGCATTTGTTATGAT pLKO_005 670 3UTR 100% 5.625 3.375 N KRTAP5-10 n/a
5 TRCN0000180336 GACCTTCAGGTTTCACCTGTT pLKO.1 648 3UTR 100% 4.050 2.430 N KRTAP5-10 n/a
6 TRCN0000254808 AGCCTCCTCACTCCGGAAATG pLKO_005 806 3UTR 100% 3.600 2.160 N KRTAP5-10 n/a
7 TRCN0000254457 CGTGTGCTGCCAGTGTAAGAT pLKO_005 610 CDS 100% 5.625 2.813 Y KRTAP5-11 n/a
8 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 567 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00915 pDONR223 100% 68.3% 62.9% None (many diffs) n/a
2 ccsbBroad304_00915 pLX_304 0% 68.3% 62.9% V5 (many diffs) n/a
3 TRCN0000473555 AATCGCAAATACTACCTAGATCGT pLX_317 94.8% 68.3% 62.9% V5 (many diffs) n/a
4 ccsbBroadEn_05666 pDONR223 100% 59.4% 59.9% None (many diffs) n/a
5 ccsbBroad304_05666 pLX_304 0% 59.4% 59.9% V5 (many diffs) n/a
6 TRCN0000475440 ACCAAGCTTTGGTAAGATGTTTGA pLX_317 10.7% 59.4% 59.9% V5 (many diffs) n/a
Download CSV