Transcript: Human NM_001013706.3

Homo sapiens perilipin 5 (PLIN5), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
PLIN5 (440503)
Length:
2470
CDS:
82..1473

Additional Resources:

NCBI RefSeq record:
NM_001013706.3
NBCI Gene record:
PLIN5 (440503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165504 GTCTGCGATGTTTACAGTGCA pLKO.1 196 CDS 100% 2.640 1.848 N PLIN5 n/a
2 TRCN0000163598 CTGTGGATGTTGTACTGGAAA pLKO.1 530 CDS 100% 4.950 2.970 N PLIN5 n/a
3 TRCN0000165505 GACAAGCTGGAAGAGAAGCTT pLKO.1 373 CDS 100% 0.300 0.180 N PLIN5 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1796 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000143567 GATCATCTGAAGTCAGGAGTT pLKO.1 1835 3UTR 100% 4.050 2.025 Y GDPD1 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1797 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 1871 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
8 TRCN0000164260 CCAACATGATGAAACCCTGTA pLKO.1 1870 3UTR 100% 4.050 2.025 Y SWSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10163 pDONR223 100% 99.9% 99.7% None 763T>C n/a
2 ccsbBroad304_10163 pLX_304 0% 99.9% 99.7% V5 763T>C n/a
3 TRCN0000475590 GGGAAGTAATAAACTTTTGATTTA pLX_317 23.5% 99.9% 99.7% V5 763T>C n/a
Download CSV