Transcript: Human NM_001013841.2

Homo sapiens signal transducing adaptor family member 2 (STAP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
STAP2 (55620)
Length:
1376
CDS:
75..1286

Additional Resources:

NCBI RefSeq record:
NM_001013841.2
NBCI Gene record:
STAP2 (55620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135154 CTACAATAGCAATCGGGACTT pLKO.1 224 CDS 100% 4.050 5.670 N STAP2 n/a
2 TRCN0000136400 CTATTTCGTGTCGCATACCAA pLKO.1 767 CDS 100% 3.000 4.200 N STAP2 n/a
3 TRCN0000135619 GCTGTTGACTATGAGAACCAA pLKO.1 1029 CDS 100% 3.000 2.400 N STAP2 n/a
4 TRCN0000136290 GCAGGGTCTCACCATTTATTT pLKO.1 203 CDS 100% 15.000 10.500 N STAP2 n/a
5 TRCN0000136099 CATCCTGAAGCCAAAGAAGTT pLKO.1 1076 CDS 100% 4.950 3.465 N STAP2 n/a
6 TRCN0000134508 GCATTTGAGAAACTCACAGAT pLKO.1 273 CDS 100% 4.950 3.465 N STAP2 n/a
7 TRCN0000138438 CGATAAGGAGAATGGCGAGAA pLKO.1 851 CDS 100% 4.050 2.835 N STAP2 n/a
8 TRCN0000134171 CAAAGTCTTTAATGGTGGCTT pLKO.1 1151 CDS 100% 2.640 1.848 N STAP2 n/a
9 TRCN0000138474 CCAAAGAAGTTGCCAAAGCCT pLKO.1 1086 CDS 100% 0.750 0.525 N STAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08553 pDONR223 100% 99.9% 99.7% None 277G>A n/a
2 ccsbBroad304_08553 pLX_304 0% 99.9% 99.7% V5 277G>A n/a
3 TRCN0000479837 ATTGAATCGACACTATGGGCACAA pLX_317 28.5% 99.9% 99.7% V5 277G>A n/a
Download CSV