Transcript: Human NM_001015056.1

Homo sapiens rhotekin (RTKN), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
RTKN (6242)
Length:
2211
CDS:
271..1812

Additional Resources:

NCBI RefSeq record:
NM_001015056.1
NBCI Gene record:
RTKN (6242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001015056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048661 CCTTGTACCATGAGATGGCTA pLKO.1 1463 CDS 100% 2.640 3.432 N RTKN n/a
2 TRCN0000428085 GCATAGGATCTGCCCAGAAGA pLKO_005 1828 3UTR 100% 4.950 3.960 N RTKN n/a
3 TRCN0000048659 CCTAAGCATCAGTAACCAGTA pLKO.1 1260 CDS 100% 4.050 3.240 N RTKN n/a
4 TRCN0000413741 TTTCTTTGACATGAGCCAATG pLKO_005 1362 CDS 100% 6.000 4.200 N RTKN n/a
5 TRCN0000048658 CCCTTTATGGTAGCGTGTGTT pLKO.1 992 CDS 100% 4.950 3.465 N RTKN n/a
6 TRCN0000048662 GCTGCTTACTATTGCTGTCAA pLKO.1 1182 CDS 100% 4.950 3.465 N RTKN n/a
7 TRCN0000425975 GGACACAGAGATGATCCTAGT pLKO_005 600 CDS 100% 4.050 2.835 N RTKN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001015056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01467 pDONR223 100% 93.2% 93.2% None 0_1ins111 n/a
2 ccsbBroad304_01467 pLX_304 0% 93.2% 93.2% V5 0_1ins111 n/a
3 TRCN0000473458 TCGCGGGCTACTGGTCGATTCCGG pLX_317 31.9% 93.2% 93.2% V5 0_1ins111 n/a
4 ccsbBroadEn_01468 pDONR223 100% 91.1% 91.1% None 0_1ins150 n/a
5 TRCN0000467114 ATCCATATCAAGTGAAAACGTATG pLX_317 21.7% 91.1% 91.1% V5 0_1ins150 n/a
Download CSV