Transcript: Human NM_001018070.2

Homo sapiens coronin 1B (CORO1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CORO1B (57175)
Length:
1949
CDS:
134..1603

Additional Resources:

NCBI RefSeq record:
NM_001018070.2
NBCI Gene record:
CORO1B (57175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116423 CCTCACAACGACGAAGTCATA pLKO.1 407 CDS 100% 4.950 6.930 N CORO1B n/a
2 TRCN0000289792 CCTCACAACGACGAAGTCATA pLKO_005 407 CDS 100% 4.950 6.930 N CORO1B n/a
3 TRCN0000116426 CGTGGTACTCATCTGGAATGT pLKO.1 598 CDS 100% 4.950 3.465 N CORO1B n/a
4 TRCN0000289790 CGTGGTACTCATCTGGAATGT pLKO_005 598 CDS 100% 4.950 3.465 N CORO1B n/a
5 TRCN0000116425 GTCAAGAACGACCAGTGCTAT pLKO.1 191 CDS 100% 4.950 3.465 N CORO1B n/a
6 TRCN0000289724 GTCAAGAACGACCAGTGCTAT pLKO_005 191 CDS 100% 4.950 3.465 N CORO1B n/a
7 TRCN0000116424 GCCCGGTTCTACAAACTGCAT pLKO.1 1136 CDS 100% 2.640 1.848 N CORO1B n/a
8 TRCN0000289725 GCCCGGTTCTACAAACTGCAT pLKO_005 1136 CDS 100% 2.640 1.848 N CORO1B n/a
9 TRCN0000116422 CGCCCAGCTTTCCTCACTGTT pLKO.1 1761 3UTR 100% 1.650 1.155 N CORO1B n/a
10 TRCN0000289726 CGCCCAGCTTTCCTCACTGTT pLKO_005 1761 3UTR 100% 1.650 1.155 N CORO1B n/a
11 TRCN0000090024 CCCTACATCCACTTCCTGAAT pLKO.1 1037 CDS 100% 4.950 3.465 N Coro1b n/a
12 TRCN0000326503 CCCTACATCCACTTCCTGAAT pLKO_005 1037 CDS 100% 4.950 3.465 N Coro1b n/a
13 TRCN0000090027 CGGTACTTTGAGATCACAGAT pLKO.1 1010 CDS 100% 4.950 3.465 N Coro1b n/a
14 TRCN0000326571 CGGTACTTTGAGATCACAGAT pLKO_005 1010 CDS 100% 4.950 3.465 N Coro1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03800 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03800 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480922 TAACAATTTGGTCCCATTGATGCA pLX_317 27.3% 100% 100% V5 n/a
Download CSV