Transcript: Human NM_001018074.1

Homo sapiens nuclear receptor subfamily 3 group C member 1 (NR3C1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Homo sapiens (human)
Gene:
NR3C1 (2908)
Length:
6614
CDS:
323..2656

Additional Resources:

NCBI RefSeq record:
NM_001018074.1
NBCI Gene record:
NR3C1 (2908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222129 GAAGTGTTATATGCAGGATAT pLKO.1 1946 CDS 100% 10.800 15.120 N NR3C1 n/a
2 TRCN0000245003 GCGGGAGAAGACGATTCATTC pLKO_005 1007 CDS 100% 10.800 15.120 N NR3C1 n/a
3 TRCN0000222127 CGGTGGCAATGTGAAATTGTA pLKO.1 853 CDS 100% 5.625 4.500 N NR3C1 n/a
4 TRCN0000245007 TTGGGTGGAGTTTCGTAATTT pLKO_005 6020 3UTR 100% 15.000 10.500 N NR3C1 n/a
5 TRCN0000238461 TTTGCTCCTGATCTGATTATT pLKO_005 2189 CDS 100% 15.000 10.500 N Nr3c1 n/a
6 TRCN0000245005 CACAGGCTTCAGGTATCTTAT pLKO_005 2282 CDS 100% 13.200 9.240 N NR3C1 n/a
7 TRCN0000245006 TGGATAAGACCATGAGTATTG pLKO_005 2544 CDS 100% 10.800 7.560 N NR3C1 n/a
8 TRCN0000222126 CCAGCATGAGACCAGATGTAA pLKO.1 1509 CDS 100% 5.625 3.938 N NR3C1 n/a
9 TRCN0000222128 CCTACATCAAAGAGCTAGGAA pLKO.1 2397 CDS 100% 3.000 2.100 N NR3C1 n/a
10 TRCN0000222125 CCTGGATGTTTCTTATGGCAT pLKO.1 2118 CDS 100% 2.640 1.848 N NR3C1 n/a
11 TRCN0000245004 GTGTCACTGTTGGAGGTTATT pLKO_005 1919 CDS 100% 13.200 7.920 N NR3C1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00693 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00693 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469869 CTCAGCCACGCCAAAACGTATTAA pLX_317 16.6% 100% 100% V5 n/a
4 TRCN0000488070 CTCCATCCTAACTGATTCTATTAG pLX_317 14.5% 99.9% 99.8% V5 (not translated due to prior stop codon) 1051T>C;2298T>C n/a
Download CSV