Transcript: Mouse NM_001024138.1

Mus musculus G protein-coupled receptor 139 (Gpr139), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gpr139 (209776)
Length:
1038
CDS:
1..1038

Additional Resources:

NCBI RefSeq record:
NM_001024138.1
NBCI Gene record:
Gpr139 (209776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178634 CTTAACGGTTGACAGGTATAT pLKO.1 339 CDS 100% 13.200 18.480 N Gpr139 n/a
2 TRCN0000178606 GTTTACCATTACCTCCATCTT pLKO.1 666 CDS 100% 4.950 6.930 N Gpr139 n/a
3 TRCN0000200161 CCTCGGGTTACCAGCAAATAT pLKO.1 90 CDS 100% 15.000 12.000 N Gpr139 n/a
4 TRCN0000219599 CTGTCTGTCACCCACTCAAAT pLKO.1 362 CDS 100% 13.200 9.240 N Gpr139 n/a
5 TRCN0000198448 GCTTAGGAGAAAGAGCAATTT pLKO.1 603 CDS 100% 13.200 9.240 N Gpr139 n/a
6 TRCN0000177878 CTTCTTTCTCTACTGCTTCAT pLKO.1 819 CDS 100% 4.950 3.465 N Gpr139 n/a
7 TRCN0000198117 CTTGAACTCCATCATTGTGTA pLKO.1 579 CDS 100% 4.950 3.465 N Gpr139 n/a
8 TRCN0000177463 GACAAGATCATAGAAGTTCTA pLKO.1 277 CDS 100% 4.950 3.465 N Gpr139 n/a
9 TRCN0000198583 CATGTTGGATGTTGCCAACAT pLKO.1 771 CDS 100% 0.495 0.347 N Gpr139 n/a
10 TRCN0000060651 CCCGCATCATCATGATTCTTT pLKO.1 704 CDS 100% 5.625 3.938 N GPR139 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04780 pDONR223 100% 88% 94% None (many diffs) n/a
2 ccsbBroad304_04780 pLX_304 0% 88% 94% V5 (many diffs) n/a
3 TRCN0000475973 AGATTAGTCTCTCAATTGTTTGCC pLX_317 33.2% 88% 94% V5 (many diffs) n/a
4 TRCN0000489785 AATCCTCTGCAGCCTTCCGTTTTT pLX_317 37.4% 87.9% 93.7% V5 (many diffs) n/a
5 TRCN0000488706 CTTAATAAGTCGAAATCCGAGGAC pLX_317 32.3% 88% 94% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489716 CGAGGCGCCGCAGTTACAATTATT pLX_317 35.4% 82.6% 88.2% V5 (many diffs) n/a
7 TRCN0000487816 TCCCTCTTACGGTAGGCACCAGTT pLX_317 26.8% 82.6% 88.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV