Transcript: Human NM_001024209.4

Homo sapiens small proline rich protein 2E (SPRR2E), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SPRR2E (6704)
Length:
679
CDS:
63..281

Additional Resources:

NCBI RefSeq record:
NM_001024209.4
NBCI Gene record:
SPRR2E (6704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001024209.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182952 CAGTTAGCTTCTTTCCTCTTA pLKO.1 384 3UTR 100% 4.950 3.465 N SPRR2E n/a
2 TRCN0000180401 GCTTCTTTCCTCTTAGCCAGT pLKO.1 390 3UTR 100% 2.160 1.296 N SPRR2E n/a
3 TRCN0000181195 CCTTTCTGAGGCTGCCATATT pLKO.1 447 3UTR 100% 13.200 6.600 Y SPRR2E n/a
4 TRCN0000158926 GCATGAAAGGATAAGGATAAT pLKO.1 303 3UTR 100% 13.200 6.600 Y SPRR2F n/a
5 TRCN0000255629 GTCCACCCAAGAGCAAGTAAC pLKO_005 262 CDS 100% 10.800 5.400 Y SPRR2D n/a
6 TRCN0000203685 CATCAGGAGCATGAAAGGATA pLKO.1 295 3UTR 100% 4.950 2.475 Y SPRR2F n/a
7 TRCN0000180537 GCCTACCATGGATACACAGTT pLKO.1 368 3UTR 100% 4.950 2.475 Y SPRR2E n/a
8 TRCN0000203973 GCATCTTCTCATCAAAGCCAT pLKO.1 352 3UTR 100% 2.640 1.320 Y SPRR2F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024209.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06991 pDONR223 100% 97.2% 95.8% None (many diffs) n/a
2 ccsbBroad304_06991 pLX_304 0% 97.2% 95.8% V5 (many diffs) n/a
3 TRCN0000467715 TCCTGGGTCCGAGCTCTAAATTCC pLX_317 100% 97.2% 95.8% V5 (many diffs) n/a
Download CSV