Transcript: Human NM_001024466.3

Homo sapiens superoxide dismutase 2 (SOD2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SOD2 (6648)
Length:
880
CDS:
75..626

Additional Resources:

NCBI RefSeq record:
NM_001024466.3
NBCI Gene record:
SOD2 (6648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001024466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005940 GCACGCTTACTACCTTCAGTA pLKO.1 515 CDS 100% 4.950 6.930 N SOD2 n/a
2 TRCN0000320739 GCACGCTTACTACCTTCAGTA pLKO_005 515 CDS 100% 4.950 6.930 N SOD2 n/a
3 TRCN0000311411 GCTTACTACCTTCAGTATAAA pLKO_005 519 CDS 100% 15.000 10.500 N Sod2 n/a
4 TRCN0000350349 TTGGTTCCTTTGACAAGTTTA pLKO_005 331 CDS 100% 13.200 9.240 N SOD2 n/a
5 TRCN0000005942 GCAAGGAACAACAGGCCTTAT pLKO.1 467 CDS 100% 10.800 7.560 N SOD2 n/a
6 TRCN0000350277 GCAAGGAACAACAGGCCTTAT pLKO_005 467 CDS 100% 10.800 7.560 N SOD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11148 pDONR223 100% 60.3% 44.4% None (many diffs) n/a
2 ccsbBroad304_11148 pLX_304 0% 60.3% 44.4% V5 (many diffs) n/a
3 TRCN0000478320 ACACATACCAAAACTCGCTCTCCT pLX_317 59% 60.3% 44.4% V5 (many diffs) n/a
Download CSV