Transcript: Mouse NM_001024717.2

Mus musculus galactose-3-O-sulfotransferase 3 (Gal3st3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gal3st3 (545276)
Length:
2442
CDS:
282..1577

Additional Resources:

NCBI RefSeq record:
NM_001024717.2
NBCI Gene record:
Gal3st3 (545276)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254985 TACGACCTTGGAGGCGACAAT pLKO_005 900 CDS 100% 4.950 6.930 N Gal3st3 n/a
2 TRCN0000254981 CTTGAGCCCTGTGTCCAAATG pLKO_005 1639 3UTR 100% 10.800 7.560 N Gal3st3 n/a
3 TRCN0000254984 GCTGCCCAGATTCGTACAAAG pLKO_005 1314 CDS 100% 10.800 7.560 N Gal3st3 n/a
4 TRCN0000254983 TGCCTCCAGACACGATCTATG pLKO_005 703 CDS 100% 10.800 7.560 N Gal3st3 n/a
5 TRCN0000254982 TGCGAGCACCAGTTCTGTTAC pLKO_005 582 CDS 100% 10.800 7.560 N Gal3st3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15205 pDONR223 98.4% 88.1% 94.6% None (many diffs) n/a
2 ccsbBroad304_15205 pLX_304 0% 88.1% 94.6% V5 (many diffs) n/a
3 TRCN0000476578 TCTGGCCTCCTCATATACATCAGT pLX_317 29.3% 88.1% 94.6% V5 (many diffs) n/a
Download CSV