Transcript: Mouse NM_001024945.1

Mus musculus quiescin Q6 sulfhydryl oxidase 1 (Qsox1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Qsox1 (104009)
Length:
3399
CDS:
101..2347

Additional Resources:

NCBI RefSeq record:
NM_001024945.1
NBCI Gene record:
Qsox1 (104009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219628 CGGTGCAGGCAAACCGATATA pLKO.1 1353 CDS 100% 13.200 18.480 N Qsox1 n/a
2 TRCN0000176690 CGACGGATTCTTTACAAGAAA pLKO.1 637 CDS 100% 5.625 7.875 N Qsox1 n/a
3 TRCN0000345841 CGACGGATTCTTTACAAGAAA pLKO_005 637 CDS 100% 5.625 7.875 N Qsox1 n/a
4 TRCN0000200307 GAGCTTGCTAACGACGTGAAA pLKO.1 353 CDS 100% 4.950 6.930 N Qsox1 n/a
5 TRCN0000345840 GAGCTTGCTAACGACGTGAAA pLKO_005 353 CDS 100% 4.950 6.930 N Qsox1 n/a
6 TRCN0000182610 GACTAGCCACAACAGGGTTAA pLKO.1 1543 CDS 100% 10.800 8.640 N Qsox1 n/a
7 TRCN0000200035 CGATTCTTTGGCTCTGGACTA pLKO.1 1527 CDS 100% 4.050 3.240 N Qsox1 n/a
8 TRCN0000219629 TCTCTTACTTTGGTCTCTAAA pLKO.1 3159 3UTR 100% 13.200 9.240 N Qsox1 n/a
9 TRCN0000177762 CATGAGGAGCTATGTTCAGTT pLKO.1 1423 CDS 100% 4.950 3.465 N Qsox1 n/a
10 TRCN0000345919 CATGAGGAGCTATGTTCAGTT pLKO_005 1423 CDS 100% 4.950 3.465 N Qsox1 n/a
11 TRCN0000178354 GAGGAGCTATGTTCAGTTCTT pLKO.1 1426 CDS 100% 4.950 3.465 N Qsox1 n/a
12 TRCN0000178524 GCTGAATGATATCGACGGATT pLKO.1 625 CDS 100% 4.050 2.835 N Qsox1 n/a
13 TRCN0000182708 CCATCTTGTTACCTGCTGCTT pLKO.1 812 CDS 100% 2.640 1.848 N Qsox1 n/a
14 TRCN0000177691 CCATAATGAACTCAACGGACA pLKO.1 1645 CDS 100% 2.160 1.512 N Qsox1 n/a
15 TRCN0000345920 CCATAATGAACTCAACGGACA pLKO_005 1645 CDS 100% 2.160 1.512 N Qsox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.