Transcript: Mouse NM_001025363.2

Mus musculus kinesin light chain 1 (Klc1), transcript variant f, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Klc1 (16593)
Length:
2406
CDS:
177..1832

Additional Resources:

NCBI RefSeq record:
NM_001025363.2
NBCI Gene record:
Klc1 (16593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100414 GACGCTGAAGTGCTTGAAGAA pLKO.1 329 CDS 100% 4.950 6.930 N Klc1 n/a
2 TRCN0000100413 CGGCTGGTATAAAGCCTGCAA pLKO.1 1526 CDS 100% 2.640 3.696 N Klc1 n/a
3 TRCN0000100410 CGTTGGATGATCTCTTCCCAA pLKO.1 700 CDS 100% 2.640 2.112 N Klc1 n/a
4 TRCN0000417326 CAACGTGGCCAAGACCAAGAA pLKO_005 1310 CDS 100% 4.950 3.465 N KLC3 n/a
5 TRCN0000100411 CCTGATGTTGCCAAACAGTTA pLKO.1 1182 CDS 100% 4.950 3.465 N Klc1 n/a
6 TRCN0000100412 GCGCTGTCCAATCACCTGAAT pLKO.1 447 CDS 100% 4.950 3.465 N Klc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00912 pDONR223 100% 84.8% 96.2% None (many diffs) n/a
2 ccsbBroad304_00912 pLX_304 0% 84.8% 96.2% V5 (many diffs) n/a
3 TRCN0000473946 GCCCCTGTGATTAGGGTCCGGGTG pLX_317 24.2% 84.8% 96.2% V5 (many diffs) n/a
Download CSV