Transcript: Human NM_001030312.2

Homo sapiens ceramide kinase like (CERKL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CERKL (375298)
Length:
2887
CDS:
102..1361

Additional Resources:

NCBI RefSeq record:
NM_001030312.2
NBCI Gene record:
CERKL (375298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001030312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195687 CTAGAGGCTTGGCACCTAATA pLKO.1 1006 CDS 100% 13.200 18.480 N CERKL n/a
2 TRCN0000195246 CCAAACGGATATCCTAATAGA pLKO.1 1686 3UTR 100% 5.625 7.875 N CERKL n/a
3 TRCN0000082582 GAGGTCCATATTAGATTGCAT pLKO.1 1287 CDS 100% 3.000 4.200 N CERKL n/a
4 TRCN0000082579 GCACCTAATACCAGATTAAAT pLKO.1 1017 CDS 100% 15.000 12.000 N CERKL n/a
5 TRCN0000082581 GCACATTCTCTTCATGGAGTT pLKO.1 600 CDS 100% 4.050 2.835 N CERKL n/a
6 TRCN0000082580 CCAAGACTTATCAGTCTTTAT pLKO.1 1308 CDS 100% 1.320 0.924 N CERKL n/a
7 TRCN0000082578 CGCACTTCTATGAGAATCTAA pLKO.1 1597 3UTR 100% 5.625 3.375 N CERKL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001030312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10069 pDONR223 100% 78.6% 78.7% None 477_478ins339;1167C>T n/a
2 TRCN0000476280 GCTCAAACTTGTACCCCAGTTATA pLX_317 18.1% 78.6% 78.7% V5 477_478ins339;1167C>T n/a
Download CSV