Transcript: Human NM_001031713.3

Homo sapiens mitochondrial calcium uniporter regulator 1 (MCUR1), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
MCUR1 (63933)
Length:
5472
CDS:
132..1211

Additional Resources:

NCBI RefSeq record:
NM_001031713.3
NBCI Gene record:
MCUR1 (63933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419936 ATATTTAGCAGGGTCTATATT pLKO_005 1145 CDS 100% 15.000 21.000 N MCUR1 n/a
2 TRCN0000435147 ACTCGAACTACATCAGTTAAA pLKO_005 881 CDS 100% 13.200 18.480 N MCUR1 n/a
3 TRCN0000418536 GGACATCGTCTACAAAGATAT pLKO_005 731 CDS 100% 13.200 18.480 N MCUR1 n/a
4 TRCN0000135627 GTGATCAAAGTCCGAACAGAT pLKO.1 921 CDS 100% 4.950 6.930 N MCUR1 n/a
5 TRCN0000136480 CAAAGTCCGAACAGATACCAA pLKO.1 926 CDS 100% 3.000 4.200 N MCUR1 n/a
6 TRCN0000430425 AGTCACACAAGCTTGATAATA pLKO_005 1120 CDS 100% 15.000 10.500 N MCUR1 n/a
7 TRCN0000134711 GCTGGAATTGAGAACAGAAAT pLKO.1 1010 CDS 100% 13.200 9.240 N MCUR1 n/a
8 TRCN0000135227 CTGCTGGAATTGAGAACAGAA pLKO.1 1008 CDS 100% 4.950 3.465 N MCUR1 n/a
9 TRCN0000136263 GTCTCAGATTGCGAATGTGAA pLKO.1 794 CDS 100% 4.950 3.465 N MCUR1 n/a
10 TRCN0000134319 GAGAACAGAAATAGTGGCATT pLKO.1 1019 CDS 100% 4.050 2.835 N MCUR1 n/a
11 TRCN0000137294 GCTTACTGGAAGACAATGGGT pLKO.1 649 CDS 100% 0.750 0.525 N MCUR1 n/a
12 TRCN0000135901 GATGAAGTGATCAAAGTCCGA pLKO.1 915 CDS 100% 0.660 0.462 N MCUR1 n/a
13 TRCN0000432953 TAATGTCTCAGATTGCGAATG pLKO_005 790 CDS 100% 6.000 3.600 N MCUR1 n/a
14 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 1287 3UTR 100% 4.950 2.475 Y CENPL n/a
15 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 2786 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03910 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03910 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478089 GGCATTCCTTTCCGGGGTCTCCCA pLX_317 13.9% 100% 100% V5 n/a
Download CSV