Transcript: Human NM_001031748.4

Homo sapiens chromosome 12 open reading frame 40 (C12orf40), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
C12orf40 (283461)
Length:
2776
CDS:
155..2113

Additional Resources:

NCBI RefSeq record:
NM_001031748.4
NBCI Gene record:
C12orf40 (283461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031748.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144531 CAAAGACTAAGTAGCAAGGAA pLKO.1 500 CDS 100% 3.000 4.200 N C12orf40 n/a
2 TRCN0000144488 CAGTTTCACTCCATCATCTTT pLKO.1 598 CDS 100% 5.625 3.938 N C12orf40 n/a
3 TRCN0000144124 CAAGAAGTATCAGAGAGAGTA pLKO.1 1276 CDS 100% 4.950 3.465 N C12orf40 n/a
4 TRCN0000145337 GAGATACTTGTGTAGTCACTA pLKO.1 1137 CDS 100% 4.950 3.465 N C12orf40 n/a
5 TRCN0000144046 CCTCAGAAACTTGCATATGAA pLKO.1 686 CDS 100% 0.000 0.000 N C12orf40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031748.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13500 pDONR223 100% 88.1% 88.1% None 1_231del n/a
2 ccsbBroad304_13500 pLX_304 0% 88.1% 88.1% V5 1_231del n/a
3 TRCN0000468983 ACCAGTTCCAATGTAGGCCAGACG pLX_317 26.8% 88.1% 88.1% V5 1_231del n/a
Download CSV