Transcript: Human NM_001031812.3

Homo sapiens casein kinase 1 gamma 3 (CSNK1G3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CSNK1G3 (1456)
Length:
4651
CDS:
720..1991

Additional Resources:

NCBI RefSeq record:
NM_001031812.3
NBCI Gene record:
CSNK1G3 (1456)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355670 TTTCGGCCCTTGTGGTAAATA pLKO_005 1031 CDS 100% 15.000 21.000 N CSNK1G3 n/a
2 TRCN0000338169 TAATGGTTGGACCTAACTTTA pLKO_005 829 CDS 100% 13.200 18.480 N CSNK1G3 n/a
3 TRCN0000023764 CCAGGTTGTAAGTTCTACAAA pLKO.1 1802 CDS 100% 0.563 0.788 N Csnk1g3 n/a
4 TRCN0000196591 GCAACATATCTTCGTTATGTA pLKO.1 1569 CDS 100% 0.563 0.788 N CSNK1G3 n/a
5 TRCN0000338228 CAAAGTAGAAGAGACGATTTA pLKO_005 1395 CDS 100% 13.200 10.560 N CSNK1G3 n/a
6 TRCN0000010550 CCCAGCAAGTTATTCACATTA pLKO.1 1249 CDS 100% 13.200 10.560 N CSNK1G3 n/a
7 TRCN0000196897 GCTAGATATATGAGCATAAAC pLKO.1 1356 CDS 100% 13.200 9.240 N CSNK1G3 n/a
8 TRCN0000196403 GTGATGTATGTTGGAGTTATA pLKO.1 2807 3UTR 100% 13.200 9.240 N CSNK1G3 n/a
9 TRCN0000355669 TTTCCAGAAATGGCAACATAT pLKO_005 1557 CDS 100% 13.200 9.240 N CSNK1G3 n/a
10 TRCN0000420971 TAGGATCTGGAGATGGTATAC pLKO_005 997 CDS 100% 10.800 7.560 N Csnk1g3 n/a
11 TRCN0000000808 CACCGAAACTTACTGCTGAAT pLKO.1 2901 3UTR 100% 4.950 3.465 N CSNK1G3 n/a
12 TRCN0000338227 CACCGAAACTTACTGCTGAAT pLKO_005 2901 3UTR 100% 4.950 3.465 N CSNK1G3 n/a
13 TRCN0000195537 CCCTACTGAAGTAGAAGTGAT pLKO.1 1880 CDS 100% 4.950 3.465 N CSNK1G3 n/a
14 TRCN0000000809 CCGGAGACAAAGAAACACATA pLKO.1 1302 CDS 100% 4.950 3.465 N CSNK1G3 n/a
15 TRCN0000338167 CCGGAGACAAAGAAACACATA pLKO_005 1302 CDS 100% 4.950 3.465 N CSNK1G3 n/a
16 TRCN0000000810 AGGACGTTCAAATGCACCCAT pLKO.1 1853 CDS 100% 2.640 1.848 N CSNK1G3 n/a
17 TRCN0000000811 ACTTCTTAATAGGACGACCAA pLKO.1 1219 CDS 100% 2.640 3.696 N CSNK1G3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06057 pDONR223 100% 99.9% 99.7% None 271A>G n/a
2 ccsbBroad304_06057 pLX_304 0% 99.9% 99.7% V5 271A>G n/a
3 TRCN0000477806 CGATTTGCAATTGATGCTTGGCAT pLX_317 26.7% 99.9% 99.7% V5 271A>G n/a
4 ccsbBroadEn_14603 pDONR223 100% 99.7% 99.2% None 526A>N;529A>N;625C>N n/a
5 ccsbBroad304_14603 pLX_304 0% 99.7% 99.2% V5 526A>N;529A>N;625C>N n/a
6 TRCN0000467288 CGAATTGCCCCTTACTCTATAGGA pLX_317 11.6% 99.7% 99.2% V5 526A>N;529A>N;625C>N n/a
7 TRCN0000489721 TTAGACGGACATTGTATCAGTATC pLX_317 94.5% 26.5% 23% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV