Transcript: Human NM_001031855.3

Homo sapiens LON peptidase N-terminal domain and ring finger 3 (LONRF3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LONRF3 (79836)
Length:
3108
CDS:
164..2443

Additional Resources:

NCBI RefSeq record:
NM_001031855.3
NBCI Gene record:
LONRF3 (79836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421742 AGCAATCGGTCTCAGATTTAT pLKO_005 1004 CDS 100% 15.000 21.000 N LONRF3 n/a
2 TRCN0000175592 CCTAGCAATGAGGTCCTTAAA pLKO.1 2365 CDS 100% 13.200 18.480 N Lonrf3 n/a
3 TRCN0000022427 TGGTGGATGTTAGCAGTTCTT pLKO.1 2315 CDS 100% 4.950 6.930 N LONRF3 n/a
4 TRCN0000416398 TGTGGTTTCATTCGCTCAAAT pLKO_005 2202 CDS 100% 13.200 9.240 N LONRF3 n/a
5 TRCN0000175956 GCACATCTTTGAGCCTTGTTA pLKO.1 1879 CDS 100% 5.625 3.938 N Lonrf3 n/a
6 TRCN0000022426 CACATGAAAGACCAGGAAGAA pLKO.1 1331 CDS 100% 4.950 3.465 N LONRF3 n/a
7 TRCN0000022425 CTGACCTTGAATGCGCTCTAT pLKO.1 1551 CDS 100% 4.950 3.465 N LONRF3 n/a
8 TRCN0000022424 GAGGTGTTTAAGAGCCCAGAA pLKO.1 2677 3UTR 100% 4.050 2.835 N LONRF3 n/a
9 TRCN0000022428 GCCTGATGATTCGTAGATGCA pLKO.1 1902 CDS 100% 2.640 1.584 N LONRF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15153 pDONR223 94.5% 99.6% 23.4% None (many diffs) n/a
2 ccsbBroad304_15153 pLX_304 0% 99.6% 23.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473633 TCATAAGATTACTGACTTCACCCA pLX_317 23.4% 99.6% 23.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV