Transcript: Human NM_001032392.2

Homo sapiens plasminogen like B1 (PLGLB1), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
PLGLB1 (5343)
Length:
3011
CDS:
64..354

Additional Resources:

NCBI RefSeq record:
NM_001032392.2
NBCI Gene record:
PLGLB1 (5343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001032392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413046 CTCTTGTGCAATCCCTAATAT pLKO_005 628 3UTR 100% 15.000 7.500 Y PLGLB2 n/a
2 TRCN0000265829 CTTGTGCAATCCCTAATATAA pLKO_005 630 3UTR 100% 15.000 7.500 Y PLGLB1 n/a
3 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2700 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
4 TRCN0000255923 ACCTGCAGGGCATTCCAATAT pLKO_005 241 CDS 100% 13.200 6.600 Y PLGLB1 n/a
5 TRCN0000414226 ATGCTATGTAATCGTTGTTAT pLKO_005 656 3UTR 100% 13.200 6.600 Y PLGLB2 n/a
6 TRCN0000118255 CCCTGGATGACTATGTGAATA pLKO.1 125 CDS 100% 13.200 6.600 Y PLGLB2 n/a
7 TRCN0000179829 CCCTGGATGACTATGTGAATA pLKO.1 125 CDS 100% 13.200 6.600 Y PLGLB1 n/a
8 TRCN0000255925 CCCTGGATGACTATGTGAATA pLKO_005 125 CDS 100% 13.200 6.600 Y PLGLB1 n/a
9 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 2670 3UTR 100% 13.200 6.600 Y CLDN18 n/a
10 TRCN0000255924 GAGCAACAATGTGTGATAATG pLKO_005 271 CDS 100% 13.200 6.600 Y PLGLB1 n/a
11 TRCN0000118253 GCATTCCAATATCACAGTAAA pLKO.1 250 CDS 100% 13.200 6.600 Y PLGLB2 n/a
12 TRCN0000118252 GCCAACTGTATTTAGGATAAT pLKO.1 799 3UTR 100% 13.200 6.600 Y PLGLB2 n/a
13 TRCN0000255926 GGAAGTCCTCCATAATCATTA pLKO_005 302 CDS 100% 13.200 6.600 Y PLGLB1 n/a
14 TRCN0000419153 ATGCTTCTCAAGTCCCTTATG pLKO_005 569 3UTR 100% 10.800 5.400 Y PLGLB2 n/a
15 TRCN0000427309 AGCAACAATGTGTGATAATGG pLKO_005 272 CDS 100% 4.950 2.475 Y PLGLB2 n/a
16 TRCN0000072316 CCCTGGTGCTATACTACTGAT pLKO.1 2331 3UTR 100% 4.950 2.475 Y PLG n/a
17 TRCN0000178840 CTTCACTGTTCAGTGTCACTA pLKO.1 155 CDS 100% 4.950 2.475 Y PLGLB1 n/a
18 TRCN0000183040 CAATGTGTGATAATGGCTGAA pLKO.1 277 CDS 100% 4.050 2.025 Y PLGLB1 n/a
19 TRCN0000118256 GTCCTCCATAATCATTAGGAT pLKO.1 306 CDS 100% 3.000 1.500 Y PLGLB2 n/a
20 TRCN0000118254 GCAGAGAAGAATGTGCAGCAA pLKO.1 197 CDS 100% 2.640 1.320 Y PLGLB2 n/a
21 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2807 3UTR 100% 5.625 2.813 Y KLHL30 n/a
22 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2807 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001032392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01217 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01217 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471881 CTAGCATCATGTCTTCGTAACTGC pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_06737 pDONR223 100% 11.5% 11.3% None (many diffs) n/a
5 ccsbBroad304_06737 pLX_304 0% 11.5% 11.3% V5 (many diffs) n/a
6 TRCN0000475970 TCACACCATCCTGCAGCGGTAGCC pLX_317 15.4% 11.5% 11.3% V5 (many diffs) n/a
Download CSV