Transcript: Human NM_001032393.2

Homo sapiens heterogeneous nuclear ribonucleoprotein H2 (HNRNPH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
HNRNPH2 (3188)
Length:
2380
CDS:
229..1578

Additional Resources:

NCBI RefSeq record:
NM_001032393.2
NBCI Gene record:
HNRNPH2 (3188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001032393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075097 CCAAGTGGTGAAGCATTTGTT pLKO.1 385 CDS 100% 5.625 2.813 Y HNRNPH2 n/a
2 TRCN0000333384 CCAAGTGGTGAAGCATTTGTT pLKO_005 385 CDS 100% 5.625 2.813 Y HNRNPH2 n/a
3 TRCN0000075096 CCATGAGAGTACATATTGAAA pLKO.1 1169 CDS 100% 5.625 2.813 Y HNRNPH2 n/a
4 TRCN0000333386 CCATGAGAGTACATATTGAAA pLKO_005 1169 CDS 100% 5.625 2.813 Y HNRNPH2 n/a
5 TRCN0000075094 CCCATGAGAGTACATATTGAA pLKO.1 1168 CDS 100% 5.625 2.813 Y HNRNPH2 n/a
6 TRCN0000075093 GCTTACTGTAAAGTGGAAGTT pLKO.1 1803 3UTR 100% 4.950 2.475 Y HNRNPH2 n/a
7 TRCN0000333316 GCTTACTGTAAAGTGGAAGTT pLKO_005 1803 3UTR 100% 4.950 2.475 Y HNRNPH2 n/a
8 TRCN0000075095 GCCTTAAAGAAACACAAGGAA pLKO.1 730 CDS 100% 3.000 1.500 Y HNRNPH2 n/a
9 TRCN0000333385 GCCTTAAAGAAACACAAGGAA pLKO_005 730 CDS 100% 3.000 1.500 Y HNRNPH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001032393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06390 pDONR223 100% 99.9% 100% None 399G>T n/a
2 ccsbBroad304_06390 pLX_304 0% 99.9% 100% V5 399G>T n/a
3 TRCN0000481409 GCGAACACAAGTCAAGATGTATTC pLX_317 31% 99.9% 100% V5 399G>T n/a
4 ccsbBroadEn_13872 pDONR223 100% 99.8% 48.1% None 639delG;969C>G n/a
5 ccsbBroad304_13872 pLX_304 0% 99.8% 48.1% V5 (not translated due to prior stop codon) 639delG;969C>G n/a
6 TRCN0000475642 CCGTTCTATAATTCCGAATGATCA pLX_317 25.8% 99.8% 48.1% V5 (not translated due to prior stop codon) 639delG;969C>G n/a
7 ccsbBroadEn_00767 pDONR223 100% 87.6% 96.2% None (many diffs) n/a
8 ccsbBroad304_00767 pLX_304 0% 87.6% 96.2% V5 (many diffs) n/a
9 TRCN0000476388 AGATTCGTCTCAGTGGCCGGGCCG pLX_317 25.4% 87.6% 96.2% V5 (many diffs) n/a
Download CSV