Transcript: Mouse NM_001033289.2

Mus musculus solute carrier family 9 (sodium/hydrogen exchanger), member 2 (Slc9a2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc9a2 (226999)
Length:
3493
CDS:
163..2607

Additional Resources:

NCBI RefSeq record:
NM_001033289.2
NBCI Gene record:
Slc9a2 (226999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068789 CGGCTGCTATTGTCGTTATAT pLKO.1 1550 CDS 100% 15.000 21.000 N Slc9a2 n/a
2 TRCN0000068790 CCAGGCGAAATGGATGAAATT pLKO.1 1948 CDS 100% 13.200 18.480 N Slc9a2 n/a
3 TRCN0000068792 GCGTGTGCCATGACAATGAAT pLKO.1 1177 CDS 100% 5.625 4.500 N Slc9a2 n/a
4 TRCN0000068791 CCAGATCAGTTCTCAAAGAAA pLKO.1 2311 CDS 100% 5.625 3.938 N Slc9a2 n/a
5 TRCN0000068788 CCGATATTTATCCTTACCTAA pLKO.1 2160 CDS 100% 4.950 3.465 N Slc9a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06964 pDONR223 100% 84.7% 66.3% None (many diffs) n/a
2 ccsbBroad304_06964 pLX_304 0% 84.7% 66.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476194 CCCAGCTCAACAACATTCATACTT pLX_317 10.4% 84.7% 66.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV