Transcript: Mouse NM_001033441.3

Mus musculus asparagine-linked glycosylation 10B (alpha-1,2-glucosyltransferase) (Alg10b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Alg10b (380959)
Length:
3727
CDS:
128..1552

Additional Resources:

NCBI RefSeq record:
NM_001033441.3
NBCI Gene record:
Alg10b (380959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069452 GTTACGTTAGTCTCGATACTT pLKO.1 1115 CDS 100% 5.625 7.875 N Alg10b n/a
2 TRCN0000069448 CCGTTACTTCATTCTACCATA pLKO.1 1375 CDS 100% 4.950 6.930 N Alg10b n/a
3 TRCN0000069451 GTGCTCAGATTTGTCAATCTT pLKO.1 410 CDS 100% 0.563 0.788 N Alg10b n/a
4 TRCN0000069449 GTCCCTAAAGAACCTGAGAAT pLKO.1 856 CDS 100% 4.950 3.465 N Alg10b n/a
5 TRCN0000034758 GTGGCCAAATAGTCAGGACAT pLKO.1 1513 CDS 100% 4.050 2.835 N ALG10 n/a
6 TRCN0000069450 CAGAGAATCTTGTCAACATTA pLKO.1 512 CDS 100% 13.200 7.920 N Alg10b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09240 pDONR223 100% 82.8% 85.8% None (many diffs) n/a
2 ccsbBroad304_09240 pLX_304 0% 82.8% 85.8% V5 (many diffs) n/a
3 TRCN0000479152 AACTGGGTGCCTGGCGGCGAATCA pLX_317 29% 82.8% 85.8% V5 (many diffs) n/a
4 ccsbBroadEn_04970 pDONR223 100% 82.4% 85.2% None (many diffs) n/a
5 ccsbBroad304_04970 pLX_304 0% 82.4% 85.2% V5 (many diffs) n/a
6 TRCN0000477661 CCTTAGCGTGTTAGTGTGTTGAGC pLX_317 31.9% 82.4% 85.2% V5 (many diffs) n/a
Download CSV