Transcript: Human NM_001033557.3

Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1B (PPM1B), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PPM1B (5495)
Length:
3028
CDS:
415..1557

Additional Resources:

NCBI RefSeq record:
NM_001033557.3
NBCI Gene record:
PPM1B (5495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001033557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002448 GAGCAGAAGAGGATGAATTTA pLKO.1 1106 CDS 100% 15.000 10.500 N PPM1B n/a
2 TRCN0000002449 ACACAAGGGAAGTCGAGATAA pLKO.1 1254 CDS 100% 13.200 9.240 N PPM1B n/a
3 TRCN0000318555 ACACAAGGGAAGTCGAGATAA pLKO_005 1254 CDS 100% 13.200 9.240 N PPM1B n/a
4 TRCN0000002451 GCTGGGAATGGTTTACGTTAT pLKO.1 466 CDS 100% 10.800 7.560 N PPM1B n/a
5 TRCN0000318495 GCTGGGAATGGTTTACGTTAT pLKO_005 466 CDS 100% 10.800 7.560 N PPM1B n/a
6 TRCN0000010709 CATCACTACTAACGAAGACTT pLKO.1 648 CDS 100% 4.950 3.465 N PPM1B n/a
7 TRCN0000318554 CATCACTACTAACGAAGACTT pLKO_005 648 CDS 100% 4.950 3.465 N PPM1B n/a
8 TRCN0000002450 GACTGAATCCACATAGAGAAA pLKO.1 1520 CDS 100% 4.950 3.465 N PPM1B n/a
9 TRCN0000318500 GACTGAATCCACATAGAGAAA pLKO_005 1520 CDS 100% 4.950 3.465 N PPM1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01255 pDONR223 100% 19.4% 18.9% None (many diffs) n/a
2 ccsbBroad304_01255 pLX_304 0% 19.4% 18.9% V5 (many diffs) n/a
3 TRCN0000479066 GCCTTGTTTCACATTTAGACTTAT pLX_317 66.4% 19.4% 18.9% V5 (many diffs) n/a
Download CSV