Transcript: Human NM_001035254.3

Homo sapiens family with sequence similarity 102 member A (FAM102A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
FAM102A (399665)
Length:
4617
CDS:
853..2007

Additional Resources:

NCBI RefSeq record:
NM_001035254.3
NBCI Gene record:
FAM102A (399665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001035254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180237 CCACCGATACTGGCACTTTAA pLKO.1 3738 3UTR 100% 13.200 18.480 N FAM102A n/a
2 TRCN0000263923 GATCGTGCAGAGCCAGGATTT pLKO_005 1848 CDS 100% 10.800 15.120 N FAM102A n/a
3 TRCN0000263926 TCTACGAGCCAGTTGTGATTG pLKO_005 1976 CDS 100% 10.800 15.120 N FAM102A n/a
4 TRCN0000263925 AGTCCAAGATCTCCGGCTACA pLKO_005 1559 CDS 100% 4.050 3.240 N FAM102A n/a
5 TRCN0000263927 GAGAGTATATCAGAGATATTT pLKO_005 4200 3UTR 100% 15.000 10.500 N FAM102A n/a
6 TRCN0000177097 CCTGGACTTCAAATTCTATAT pLKO.1 4166 3UTR 100% 13.200 9.240 N Fam102a n/a
7 TRCN0000292818 CCTGGACTTCAAATTCTATAT pLKO_005 4166 3UTR 100% 13.200 9.240 N Fam102a n/a
8 TRCN0000263924 CATCTGTCCGATCGCTCTTTC pLKO_005 1747 CDS 100% 10.800 7.560 N FAM102A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001035254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10115 pDONR223 100% 62.9% 63% None 1_426del;1014T>C n/a
2 ccsbBroad304_10115 pLX_304 68.3% 62.9% 63% V5 1_426del;1014T>C n/a
3 TRCN0000480115 ACTTTTGCCAATGGCGAATCCTCA pLX_317 54.5% 62.9% 63% V5 1_426del;1014T>C n/a
Download CSV