Transcript: Human NM_001037341.1

Homo sapiens phosphodiesterase 4B (PDE4B), transcript variant d, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PDE4B (5142)
Length:
4309
CDS:
192..2402

Additional Resources:

NCBI RefSeq record:
NM_001037341.1
NBCI Gene record:
PDE4B (5142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048818 GCATAGTTCAAGCCTAAACAA pLKO.1 1136 CDS 100% 5.625 7.875 N PDE4B n/a
2 TRCN0000423795 ACTGAACTCACTGACTAATAA pLKO_005 2733 3UTR 100% 15.000 10.500 N PDE4B n/a
3 TRCN0000427257 ATGCATCATGTATGCTATATT pLKO_005 1286 CDS 100% 15.000 10.500 N PDE4B n/a
4 TRCN0000434078 ATAACCTACATGATGACTTTA pLKO_005 1356 CDS 100% 13.200 9.240 N PDE4B n/a
5 TRCN0000414534 CTCCTGAGGGAGATGGTATTT pLKO_005 385 CDS 100% 13.200 9.240 N PDE4B n/a
6 TRCN0000413944 ACCATTCTGACGTGGCATATC pLKO_005 1387 CDS 100% 10.800 7.560 N PDE4B n/a
7 TRCN0000114915 CCAGATAAGTGGAGTGAAGAA pLKO.1 1109 CDS 100% 4.950 3.465 N Pde4b n/a
8 TRCN0000048822 CCTCCTAAAGACATTCAGAAT pLKO.1 1319 CDS 100% 4.950 3.465 N PDE4B n/a
9 TRCN0000048821 GCTTGAGTAAATCCTACAGTT pLKO.1 259 CDS 100% 4.950 3.465 N PDE4B n/a
10 TRCN0000048820 CCTTGGAATTGTATCGGCAAT pLKO.1 1903 CDS 100% 4.050 2.835 N PDE4B n/a
11 TRCN0000048819 GCGCAGAGAGTCATTTCTCTA pLKO.1 578 CDS 100% 0.495 0.347 N PDE4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06703 pDONR223 100% 99.9% 99.8% None 315G>N n/a
2 ccsbBroad304_06703 pLX_304 0% 99.9% 99.8% V5 315G>N n/a
3 TRCN0000477230 ACAAGCGGTCCATTGACATACTCA pLX_317 13.9% 99.9% 99.8% V5 315G>N n/a
Download CSV