Transcript: Mouse NM_001038610.2

Mus musculus dachshund 1 (Drosophila) (Dach1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dach1 (13134)
Length:
5310
CDS:
457..2556

Additional Resources:

NCBI RefSeq record:
NM_001038610.2
NBCI Gene record:
Dach1 (13134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085974 GCATCGACAAACTTTCTCTAA pLKO.1 2042 CDS 100% 4.950 6.930 N Dach1 n/a
2 TRCN0000118090 ACTCTCACATCATGCCGCATT pLKO.1 1337 CDS 100% 4.050 5.670 N DACH1 n/a
3 TRCN0000085977 CGCAAGAGACAGCATCGACAA pLKO.1 2031 CDS 100% 4.050 5.670 N Dach1 n/a
4 TRCN0000433533 GACAGTCTCCGGGTCTTAAAT pLKO_005 2428 CDS 100% 15.000 10.500 N Dach1 n/a
5 TRCN0000424048 ACTACTGTCATGTACTGAATA pLKO_005 2539 CDS 100% 13.200 9.240 N Dach1 n/a
6 TRCN0000423957 AGACTCTTCTCACTAACATAC pLKO_005 2135 CDS 100% 10.800 7.560 N Dach1 n/a
7 TRCN0000085973 CCCAGAGAACTCTCACATCAT pLKO.1 1329 CDS 100% 4.950 3.465 N Dach1 n/a
8 TRCN0000085975 GAGCAACTATCATGCCAGTAA pLKO.1 1491 CDS 100% 4.950 3.465 N Dach1 n/a
9 TRCN0000085976 CCTCTACAATGACTGCACCAA pLKO.1 1257 CDS 100% 2.640 1.848 N Dach1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13842 pDONR223 100% 68.4% 3% None (many diffs) n/a
2 ccsbBroad304_13842 pLX_304 0% 68.4% 3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474576 CCGCATCAATTTCGCCTCTGTCTC pLX_317 17.9% 68.4% 3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV