Transcript: Mouse NM_001039368.2

Mus musculus polymerase (RNA) II (DNA directed) polypeptide K (Polr2k), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Polr2k (17749)
Length:
626
CDS:
91..390

Additional Resources:

NCBI RefSeq record:
NM_001039368.2
NBCI Gene record:
Polr2k (17749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021880 CAGAGAATGTGGATACAGAAT pLKO.1 321 CDS 100% 4.950 2.970 N POLR2K n/a
2 TRCN0000021882 CAGATGCAGAGAATGTGGATA pLKO.1 315 CDS 100% 4.950 2.970 N POLR2K n/a
3 TRCN0000352914 CAGATGCAGAGAATGTGGATA pLKO_005 315 CDS 100% 4.950 2.970 N POLR2K n/a
4 TRCN0000111412 GCAGAGAATGTGGATACAGAA pLKO.1 320 CDS 100% 4.950 2.970 N Polr2k n/a
5 TRCN0000332511 GCAGAGAATGTGGATACAGAA pLKO_005 320 CDS 100% 4.950 2.970 N Polr2k n/a
6 TRCN0000111411 GCAGCAGCCAATGATATATAT pLKO.1 246 CDS 100% 15.000 7.500 Y Polr2k n/a
7 TRCN0000332513 GCAGCAGCCAATGATATATAT pLKO_005 246 CDS 100% 15.000 7.500 Y Polr2k n/a
8 TRCN0000111410 GCCTCATTGATGTTTCTCTTT pLKO.1 428 3UTR 100% 4.950 2.475 Y Polr2k n/a
9 TRCN0000332444 GCCTCATTGATGTTTCTCTTT pLKO_005 428 3UTR 100% 4.950 2.475 Y Polr2k n/a
10 TRCN0000111413 GTGGAGAGTGTCACACCGAAA pLKO.1 269 CDS 100% 4.050 2.025 Y Polr2k n/a
11 TRCN0000332512 GTGGAGAGTGTCACACCGAAA pLKO_005 269 CDS 100% 4.050 2.025 Y Polr2k n/a
12 TRCN0000111414 GATAAAGTCCAGGGATCCCAT pLKO.1 294 CDS 100% 2.640 1.320 Y Polr2k n/a
13 TRCN0000332443 GATAAAGTCCAGGGATCCCAT pLKO_005 294 CDS 100% 2.640 1.320 Y Polr2k n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13922 pDONR223 100% 53.8% 56.5% None (many diffs) n/a
2 ccsbBroad304_13922 pLX_304 0% 53.8% 56.5% V5 (many diffs) n/a
3 TRCN0000472343 GATTGGCTTTTCCGTATGTTGTGT pLX_317 100% 53.8% 56.5% V5 (many diffs) n/a
Download CSV