Transcript: Human NM_001039374.5

Homo sapiens coiled-coil domain containing 183 (CCDC183), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
CCDC183 (84960)
Length:
1716
CDS:
61..1665

Additional Resources:

NCBI RefSeq record:
NM_001039374.5
NBCI Gene record:
CCDC183 (84960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039374.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129548 GATCGACAAGATCCACACGAA pLKO.1 807 CDS 100% 2.640 3.696 N CCDC183 n/a
2 TRCN0000130958 CCTCGATTTGAACAGCAAGCT pLKO.1 1362 CDS 100% 2.640 2.112 N CCDC183 n/a
3 TRCN0000131032 CAGAACATCCACCTGCTGTAT pLKO.1 556 CDS 100% 4.950 3.465 N CCDC183 n/a
4 TRCN0000129442 GAGAAGGTCAAGAGTGCTGTA pLKO.1 970 CDS 100% 4.050 2.835 N CCDC183 n/a
5 TRCN0000131113 GCAGAAGAAGCTGATCGACAA pLKO.1 795 CDS 100% 4.050 2.835 N CCDC183 n/a
6 TRCN0000128335 GATATGAAGATCATGTCCCAA pLKO.1 676 CDS 100% 2.640 1.848 N CCDC183 n/a
7 TRCN0000129273 CAAGATCATCACCAGCCAGAA pLKO.1 540 CDS 100% 4.050 2.430 N CCDC183 n/a
8 TRCN0000346370 AGCTGCGCAAGTACGTCTTTG pLKO_005 344 CDS 100% 10.800 15.120 N Ccdc183 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039374.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12895 pDONR223 100% 43% 25.6% None 1_264del;665_666delAG;957_1602del n/a
2 ccsbBroad304_12895 pLX_304 0% 43% 25.6% V5 1_264del;665_666delAG;957_1602del n/a
3 TRCN0000474565 CACAGAGGCGATGCCGTTAAGGGG pLX_317 31.2% 43% 25.6% V5 1_264del;665_666delAG;957_1602del n/a
4 ccsbBroadEn_14323 pDONR223 98.3% 10.2% 7.5% None (many diffs) n/a
5 ccsbBroad304_14323 pLX_304 0% 10.2% 7.5% V5 (many diffs) n/a
6 TRCN0000465574 CAACATATCGTGCACATGACTGCC pLX_317 100% 10.2% 7.5% V5 (many diffs) n/a
Download CSV